Assessing knowledge and willingness to use genetically modified crops in Uganda

Background: There has been a lot of debate on genetically modified (GM) crops both globally and locally in Uganda. Whereas some of the debates have been informed by scientific research, many are not. The level of acceptance and attitudes of people towards GM crops is a function of their knowledge. However, there is a paucity of studies on the knowledge and attitudes of Ugandans on GM crops. This study aimed to assess the level of knowledge of GM crops in Uganda. Methods: We carried out a mixed methods study in September 2021 in Bushenyi, Jinja and Wakiso districts. We conducted 18 focus group discussions (FGDs), 13 key informant interviews (KIIs) and 698 quantitative interviews. The quantitative interviews were conducted using structured questionnaires. The FGD and KI interviews were audio recorded and transcribed verbatim. The qualitative data were analyzed using framework analysis and the quantitative data were analyzed using modified Poisson regression to identify factors associated with the level of knowledge of GM crops in STATA 15. Results: Out of the 698 respondents interviewed, only 273 (39.1%) had ever heard of GM crops. About 204 (74.7%) of the 273 respondents reported having a moderate–high understanding of GM crops and 62.3% (170) of the respondents further reported that GM crops are harmful to their health and environment, despite some of their intrinsic benefits, such as high productivity, improved income and resilience to pests and diseases. In addition, Out of the 698 respondents interviewed, only 37.7% were wary of the possibility of the emergence of super pests due to the development of resistance to some GM crops. Conclusions: Most of the community members do not have adequate knowledge about GM crops, hence, there is need for sensitization and legislation on GM crops before their release to the public

Clonning and characterization of alfa-globulin promoter into an expression vector

The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population. The manipulation of targeted gene in endosperm is a reliable tissue for the production of recombinant proteins over other tissues because it is more cost-effective, it is easier to scale-up agricultural yield, provides a larger storage ability and safe long-term storage. However only a few endosperm-specific promoters have been identified. The present research, successfully constructed the recombinant plasmid, pCAMGpro from the expression vector, pCAMBIA1305.2 containing the strong endosperm-specific a-globulin promoter (AsGpro). The AsGpro was successfully amplified from pmCACA:GFP using the forward primer, AsGproF_HindIII (5' CACAAACGTGCAAAAGCTTAATTCG 3') and the reverse primer, AsGproR_BamHI (5' GACGGATCCGAGATTGTAGAAGG 3') at 55°C. The size of the promoter fragment was approximately 848 bp. Sequencing and subsequent bioinformatics analysis, confirmed 98% homology of nucleotides to A. sativa (Glo1) gene, promoter region (Accession number: AY795082.1). This fragment was then cloned into pMR104a to generate the recombinant plasmid pMRGpro. Subsequent cloning of the recombinant cassette into the expression vector, pCAMBIA1305.2 to create the new recombinant plasmid, pCAMGpro was achieved. These finding can be used to genetically modify rice to express high levels of endosperm specific nutritional proteins of interest that would increase food production and help in alleviating the food crisis facing the world

Mercury Accumulation in Food Crops and Phytoremediation Potential of Wild Plants Thriving in Artisanal and Small-Scale Gold Mining Areas in Uganda

Mercury (Hg) has been used for millennia in artisanal and small-scale gold mining (ASGM) to extract gold from ore as an amalgam that is heated to recover gold. Since there is hardly any sustainable technology that can be used to recover it, the vast percentage of released Hg finds its way into the environment. Currently, ASGM is the largest source of mercury pollution on Earth. Mercury (Hg) is listed among the top 10 most harmful metals by the World Health Organization (WHO), and it is known to cause several neurological disorders in humans. Thus, Hg levels in environmental systems surrounding pollution hotspots such as ASGM mines need to be monitored to ensure their proper management and protect vulnerable ecosystems and human health. This work was aimed to study the level of Hg pollution in soils and plants thriving around ASGM mines in Eastern Uganda and to evaluate the Hg phytoremediation potential of the plants. The total Hg contents were determined for soils, food crops and wild plants growing around ASGM mines. The results for the pH, organic carbon (OC) and electric conductivity (EC) of the soils in the study area were comparable to those of the control soils. The soils in the studied ASGM areas exhibited high Hg concentrations ranging between 723 and 2067 folds more than those of the control soils. All soils were moderately to heavily contaminated according to geoaccumulation (Igeo) index values that ranged between 1.16 and 3.31. The results of this study also showed that the food crops and wild plants accumulated Hg levels that were above the 20 ng/g (0.02 ppm) permissible limit. This study revealed relatively higher levels of Hg in the aerial parts of the plants compared with the underground organs, which can be attributed to Hg deposition, entry through stomata and foliar adsorption. Mercury levels in 47% of the food crop samples were above the FAO/WHO permissible mercury limit of 0.5 µg/g. Similarly, medicinal plants accumulated Hg to levels that were several folds higher than the 0.2 ppm permissible limit of mercury in herbal materials of Canada. Interestingly, this study showed that some wild plant species, especially sedges, exhibited relatively higher levels of mercury accumulation than others thriving in the same environment, an indication that such plants could be utilized in the phytoremediation of Hg-contaminated sites

Assessing knowledge and willingness to use genetically modified crops in Uganda

Abstract Background There has been a lot of debate on genetically modified (GM) crops both globally and locally in Uganda. Whereas some of the debates have been informed by scientific research, many are not. The level of acceptance and attitudes of people towards GM crops is a function of their knowledge. However, there is a paucity of studies on the knowledge and attitudes of Ugandans on GM crops. This study aimed to assess the level of knowledge of GM crops in Uganda. Methods We carried out a mixed methods study in September 2021 in Bushenyi, Jinja and Wakiso districts. We conducted 18 focus group discussions (FGDs), 13 key informant interviews (KIIs) and 698 quantitative interviews. The quantitative interviews were conducted using structured questionnaires. The FGD and KI interviews were audio recorded and transcribed verbatim. The qualitative data were analyzed using framework analysis and the quantitative data were analyzed using modified Poisson regression to identify factors associated with the level of knowledge of GM crops in STATA 15. Results Out of the 698 respondents interviewed, only 273 (39.1%) had ever heard of GM crops. About 204 (74.7%) of the 273 respondents reported having a moderate–high understanding of GM crops and 62.3% (170) of the respondents further reported that GM crops are harmful to their health and environment, despite some of their intrinsic benefits, such as high productivity, improved income and resilience to pests and diseases. In addition, Out of the 698 respondents interviewed, only 37.7% were wary of the possibility of the emergence of super pests due to the development of resistance to some GM crops. Conclusions Most of the community members do not have adequate knowledge about GM crops, hence, there is need for sensitization and legislation on GM crops before their release to the public

Xanthomonas campestris pv. musacearum Bacterial Infection Induces Organ-Specific Callose and Hydrogen Peroxide Production in Banana

Xanthomonas campestris pv. musacearum (Xcm) bacteria cause banana Xanthomonas wilt (BXW), the most destructive disease of bananas in East and Central Africa. During early stages of infection in susceptible banana cultivars, incomplete systemic movement of Xcm limits bacterial colonization in the upper organs. The mechanistic basis of this delayed movement is unknown. We hypothesized that Xcm infection triggers basal pattern-triggered immune (PTI) responses whose spatial and temporal variability along the banana's anatomical structure accounts for initially limiting Xcm in upper organs. Hence, we examined PTI responses such as callose deposition and hydrogen peroxide (H2O2) production in different organs in response to Xcm infection in BXW-susceptible Kayinja and Mbwazirume banana cultivars and wild resistant progenitor Musa balbisiana. Xcm-induced callose increased and peaked at 14 days postinoculation (dpi) and 28 dpi as assessed by fluorescence microscopy and enzyme-linked immunosorbent assays, respectively. The levels of Xcm-induced H2O2 and callose were highest in the pseudostems and corms, respectively, and were independent of host susceptibility or resistance to BXW.  H2O2 production showed a biphasic transient pattern with an initial increase at 1-hour post Xcm inoculation (hpi), followed by a decline 3 to 6 hpi and then a second increase by 12 hpi. Our findings point to organ-specific responses to Xcm infection in bananas. The corm, which doubles as a subterranean perennating organ and interface between mother plants and lateral shoots, was the most responsive organ in callose production, whereas the pseudostem was the most responsive organ in H2O2 production, suggesting the significance of these organs in banana response to BXW. [Graphic: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license