Staphylococcus aureus enterotoxigênicos em leite de cabra e seus derivados, um risco à Saúde Pública

A caprinocultura leiteira é considerada como uma das principais atividades agropecuárias da região Nordeste, sendo uma importante fonte de geração de renda e de empregos. Entretanto é uma atividade de baixa tecnificação, fato preocupante para a saúde pública, visto que o leite caprino e seus derivados podem ser importantes veiculadores de microrganismos causadores de Doenças Transmitidas por Alimentos. Dentre os microrganismos destaca-se o Staphylococcus aureus, agente infeccioso responsável por casos de intoxicação alimentar envolvendo o leite caprino e seus derivados. Apesar da importância, estudos sobre sua qualidade microbiológica ainda são escassos, sendo esta revisão um alerta quanto à necessidade de avaliação microbiológica do leite caprino e derivados comercializados no Nordeste brasileiro

Staphylococcus spp. multirresistente em leite de cabra: um sério problema de Saúde Única

A caprinocultura leiteira é uma das atividades agropecuárias mais consolidadas na região semiárida brasileira. Apesar de sua importância, existem diversas limitações para o seu desenvolvimento. Dentre os entraves, destaca-se a mastite caprina, doença mundialmente reconhecida como a principal causa de perdas econômicas na caprinocultura leiteira. Além disso, o mais grave é a possível veiculação de patógenos infecciosos multirresistentes por produtos lácteos contaminados. A resistência antimicrobiana é mundialmente tratada como uma das principais ameaças à Saúde Única. Neste contexto, Staphylococcus spp. é considerado um dos principais patógenos, pois é capaz de portar diversos mecanismos de resistência aos antimicrobianos. Por estes motivos, esta revisão aborda os impactos causados pela mastite caprina no Brasil e os mecanismos de resistência aos antimicrobianos de Staphylococcus spp., bem como, os perigos à saúde humana e animal

Fatores de virulência de Staphylococcus aureus

Nas últimas décadas, Staphylococcus aureus (S. aureus) adquiriu considerável importância relacionada à saúde animal e humana pela elevada patogenicidade e aumento na prevalência de cepas multirresistentes aos antibióticos. Sua elevada patogenicidade está relacionada com mecanismos multifatoriais e complexos determinados pela capacidade da bactéria de expressar uma variedade de fatores de virulência que facilitam a ocorrência de doenças. Objetivou-se com esta revisão compilar informações referentes aos fatores de virulência associados à superfície ou secretados por S. aureus que promovem adesão aos componentes da matriz extracelular do hospedeiro, danificam células hospedeiras e interferem no sistema imunológico. A implementação de estratégias para a prevenção e terapia em infecções associadas a S. aureus exige o aprofundamento dos estudos nos diferentes mecanismos de ação dos fatores de virulência

Phenotypic and Genotypic Characteristics and Resistance Profile of Staphylococcus spp. from Bovine Mastitis

Background: Bovine mastitis remains one of the health problems that cause the most damage to milk producers. The negative impact of mastitis is due to reduced milk production, early slaughter of females, reduced commercial value of the affected animals, losses in the genetic potential of the herd, expenses with medicines and veterinary medical assistance. Staphylococcus spp. stands out as the cause of this disease and has been able to remain in the mammary gland, becoming resistant to several antimicrobials. The aims of the present study were to characterize the phenotypes, genotypes and resistance profiles of Staphylococcus spp. isolates from bovine mastitis cases in the state of Pernambuco, Brazil.Materials, Methods & Results: These isolates were classified according to biochemical tests and the presence of the nuc gene.  The polymerase chain reaction (PCR) for amplification of the mecA and blaZ genes was used to analyze the genetic potentials of antimicrobial resistance. Isolates were also phenotypically tested for resistance to nine antimicrobials (ampicillin, doxicillin, erythromycin, gentamicin, rifampicin, cephalothin, amoxicillin, nalidixic acid and oxacillin). The genetic potentials for biofilm production were evaluated by the amplifications of the icaD, icaA and bap genes. The phenotypic test of gentian violet was used for biofilm formation analyzes. Ninety-three (93.0%) of the isolates among the Staphylococcus spp. samples were classified as Staphylococcus aureus. The lowest percentage of sensitivity observed was for amoxicillin (28.0%). All of the isolates were sensitive to erythromycin and gentamicin, and 15 (15%) exhibited sensitivity to all of the drugs tested. All of the isolates were negative for the mecA gene, and 36 (36%) were positive for blaZ. In the adhesion microplate tests, 44 (44%) of the isolates were capable of biofilm formation. Of these, seven (15.9%) were strong formers, whereas 16 (36.3%) and 21 (47.8%) were moderate and weak formers, respectively. The icaD gene was confirmed in 89 (89%) of the isolates. The icaA gene was confirmed in 61 (61%) samples, and the bap gene in 52 (52%) samples. One of the samples did not possess icaA, icaD or bap and exhibited moderate biofilm formation according to the microplate adherence test. Sixteen isolates simultaneously exhibited the three genes tested for biofilm production (icaA, icaD and bap) and were negative according to the microplate adherence test.Discussion:  The indiscriminate use of antibiotics to treat mastitis is a common practice in the study area, which may have contributed to the high proportion of herds (88.23%; 15/17) with multi-resistant isolates, constituting a selection factor for the dissemination of resistant bacteria among herds.  The absence of the mecA gene in the present study may be associated with the development of resistant bacteria through another mechanism, such as the overproduction of beta-lactamases. The results demonstrate that antimicrobial resistance occurs in Staphylococcus spp. that cause bovine mastitis in herds of Pernambuco and that these isolates have the a great capacity for biofilm formation. It is necessary to sensitize the professionals involved in the milk production chain of Brazil regarding the importance of the adequate use of antimicrobials for the treatment and control of mastitis, since studies in the country indicate the dissemination of resistant bacterial strains

Occurrence of Multi-Resistant Staphylococcus aureus in Artisan Goat Coalho Cheese in Northeastern Brazil

Background: The artisanal goat coalho cheese is one of the products obtained that stand out in 11 the dairy goat farming of the Northeast of Brazil. Despite its importance, goat cheese is often 12 made under inadequate hygienic-sanitary conditions and usually uses raw goat's milk, 13 increasing the risk of product contamination. Among the pathogens carried by goat coalho 14 cheese, Staphylococcus aureus stands out, being responsible for cases of food poisoning and 15 persistent infections that are difficult to treat. This study aimed to evaluate the contamination, 16 genotypic and phenotypic resistance of Staphylococcus aureus isolated from artisanal coalho 17 cheese made with goat milk produced in the Northeast region of Brazil.Materials, Methods & Results: This study analyzed only artisanal coalho cheeses made with  raw goat's milk and purchased directly from farms. Twelve samples of artisanal coalho cheeses  made with raw goat's milk were collected (1 sample per property) in 8 municipalities in the  state of Pernambuco, Northeast region of Brazil. For microbiological analysis of enumeration  of Colony Forming Units (CFU/g) of Staphylococcus spp. the methodology recommended by the International Organization for Standardization (2019) and recognized by the Ministry of Agriculture, Livestock and Supply was used. After enumeration, 5 colonies were selected per enumerated plate, a total of 180 Staphylococcus spp. was obtained. These were subjected to thermal extraction of genetic material to search for the nuc gene by Polymerase Chain Reaction, the isolates carrying the nuc gene were subjected to genotypic and phenotypic evaluation of  antimicrobial resistance. After the phenotypic analysis, the Multiple Antimicrobial Resistance Index was evaluated. In all samples, Staphylococcus spp. and were considered unfit for consumption, with the lowest count being 9.4x103 CFU/g and the highest 6.4x106 CFU /g. Of the 180 isolates, 28.34% (51/180) were positive for the detection of the nuc gene. All resistance  genes except mecA, mecC, and norB were detected. Of the 51 S. aureus isolates, 31.37% (16/51) were considered multi-resistant and presented a Multiple Antimicrobial Resistance Index above 0.2.Discussion: After microbiological analysis it was found that all samples of coalho cheese were out of standards and unfit for human consumption in accordance with Ordinance n° 146/1996 of the Ministry of Agriculture, Livestock and Supply of Brazil. Furthermore, the contamination of goat coalho cheeses is a risk to public health. During sample collection were found inadequate hygiene conditions in the environment used for cheese production. The presence of Staphylococcus aureus can be attributed to hygienic-sanitary failures in cheese production. From a health point of view, it is even more alarming when it comes to S. aureus carrying resistance genes. Although the 51 S. aureus isolates did not carry the mecA, mecC, norB genes and did not show phenotypic resistance to cefoxitin and oxacillin, all other genes were detected, indicating the circulation of S. aureus carrying the tet(L) genes, tet(M), tet-38, msrA, norA, and norC, which so far had not been reported in the production chain of goat coalho cheese in Brazil. Furthermore, the evaluation of the Multiple Antimicrobial Resistance Index identified the occurrence of multiple resistance to antimicrobials in 31.37% (16/51) of S. aureus at high risk to human health. The results obtained are quite worrying and serve as a warning to the scientific community and the Food Safety and Hygiene Inspection Services.Keywords: goat cheese, contamination, resistance, one healt

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction  was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems

In vitro evaluation of the efficacy of commercial disinfectants used in pre and post-dipping against Staphylococcus spp. isolated from bovine mastitis

Objetivou-se com este estudo avaliar a sensibilidade in vitro de Staphylococcus spp.frente a alguns desinfetantes comerciais utilizados no pré e pós-dipping em vacas leiteiras. Foram testados um total de 60 isolados de Staphylococcus spp. identificados como S. aureus (50) e Staphylococcus coagulase positiva (10) recuperados de glândulas mamárias de vacas com mastite subclínica procedentes das regiões Metropolitana do Recife, Agreste e Zona da Mata do Estado de Pernambuco. O estudo da eficácia dos desinfetantes utilizados no pré e pós-dipping foi realizado utilizando-se os seguintes princípios ativos: cloro (2,5%), iodo (0,57%), clorexidine (2,0%), amônia quaternária (4,0%) e ácido lático (2,0%) em quatro tempos distintos (15", 30", 60" e 300"). Observou-se que 100% de S. aureus foram sensíveis ao iodo, 93,3% sensíveis a clorexidine, 80% sensíveis a amônia, 35,6% sensíveis ao ácido lático e 97,8% resistentes ao cloro no tempo de 60". Com relação a Staphylococcus coagulase positiva (SCP), 100% dos isolados foram sensíveis ao iodo, 81,8% sensíveis a amônia quaternária, 99,9% sensíveis ao ácido lático, 72,7% sensíveis a clorexidine e 100% resistentes ao cloro no tempo de 60". Conclui-se que a maior atividade desinfetante in vitro foi verificada para o iodo e clorexidine frente a S. aureus e do iodo e ácido lático frente aos SCP e que há necessidade de avaliação periódica dos desinfetantes utilizados nas propriedades leiteiras nas regiões estudadas, pois, existem variações no perfil de sensibilidade e resistência aos desinfetantes que podem comprometer os programas de controle da mastite bovina causada por Staphylococcus spp.The objective of this investigation was to evaluate the in vitro sensibility of Staphylococcus spp. to several commercially available disinfectants used for pre and post dipping. A total of 60 isolates of Staphylococcus spp., identified as Staphylococcus aureus (50) and Positive coagulase Staphylococcus (10) were obtained from the mammary glands of dairy cows with subclinical mastitis in the regions of Metropolitan Recife, the Agreste and the Zona da Mata of the State of Pernambuco, Brazil. As active ingredients were used a chlorine base (25%), iodine (0.6%), chlorhexidine (2.0%), quaternary ammonium (4.0%), and lactic acid (2.0%) at four specific intervals (15", 30", 60", and 300"). One hundred percent of S. aureus was found to be sensitive to iodine, 93.3% to chlorhexidine, 80% to ammonia, 35.6% to lactic acid, and 97.8% were resistant to chlorine at a 60-minute interval. With respect to the Positive coagulase Staphylococcus (SCP), 100.0% of the isolates were sensitive to iodine, 81.8% to quaternary ammonium, 99.9% to lactic acid, 72.7% to chlorhexidine, and 100% was resistant to chlorine at an interval of 60 minutes. It can be concluded that the highest disinfectant activity in vitro was found to be with iodine and chlorhexidine for S. aureus, and with iodine and lactic acid for SCP. A further conclusion was that it is important to undertake a periodic evaluation of the disinfectants used on the dairy properties in the regions studied, given the variety of sensibilities and resistance to disinfectants used, which may prejudice the control of bovine mastitis caused by Staphylococcus spp

Catarrhal mastitis by Staphylococcus simulans in a nulliparous goat

O presente trabalho é o relato do caso de uma cabra nulípara da raça Parda Alpina, de um ano de idade, pertencente ao Setor de Caprinocultura da Universidade Federal da Paraíba – Bananeiras - Brasil. Ambas as glândulas foram naturalmente infectadas por Staphylococcus simulans α-hemolítico. As glândulas mamárias apresentaram mastite aguda catarral com envolvimento sistêmico, respondendo positivamente ao tratamento sistêmico com gentamicina associada a amoxicilina. O presente relato sugere a importância do potencial patogênico de Staphylococcus não-aureus (SNA) como causador de mastite clínica também em animais nulíparos. O isolado mostrou resistência a tetraciclina e continha genes de produção de toxinas estafilocócicas (sec, seg e TSST-1). Além disso, tem sido relatado que Staphylococcus simulans é um patógeno emergente em seres humanos causando infecções cutâneas e osteoarticulares, principalmente naqueles que têm contato íntimo com animais de fazenda. Até onde sabemos, este é o primeiro relato de uma mastite clínica em uma cabra nulípara causada por Staphylococcus simulans.The present paper is a case report of a one-year old nulliparous Alpine Goat belonging to a dairy goat farm in semi-arid region of Brazil. Both glands were naturally infected by α-hemolytic Staphylococcus simulans and evolved similar clinical signs. The mammary glands presented an acute catarrhal mastitis with systemic clinical signs that responded positively to treatment with gentamicin associated with amoxicillin. The present report suggests the importance of the pathogenic potential of non-aureus Staphylococci strains (NAS) as a cause of clinical mastitis also in nulliparous animals. The isolate showed resistance to tetracycline and contained staphylococcal toxin production genes (sec, sec and TSST-1). Moreover, it has been reported that Staphylococcus simulans is an emerging pathogen in humans causing cutaneous and osteoarticular infections, mainly in those in close contact with farm animals. To the best of our knowledge, this is the first report of a clinical mastitis in a nulliparous goat caused by Staphylococcus simulans

Phytochemical investigation of hexanic extract of the Melaleuca leucadendra (l) l. Myrtaceae: Investigação fitoquímica do extrato hexânico da Melaleuca leucadendra (l) l. Myrtaceae

Studies on the effectiveness of species of the genus Melaleuca (Myrtaceae) against mastitis-causing bacteria, particularly Staphylococcus aureus, have focused on the chemical components of the essential oil. The goal of this work was to use GC-MS analysis to characterize the phytochemical composition of the hexane extract from Melaleuca leucadendra (L) L. leaves. There was evidence of 37 secondary metabolites, including 2-Hexadecen-1-ol, Nerolidol B (Cis or Trans), Heneicosan, Vitamin E, 3, 7, 11, and 15-Tetramethyl-, and [R-[R*,R*-(E)]]. Squalene, Cyclopropanemethanol, Gamma-Sitosterol, (-)-Caryophyllene Oxide, and Neophytadiene. The plant Melaleuca leucadendra (L) L. can be regarded as a source of nonpolar compounds with promise for the treatment of mastitis because of the significance and the wide range of biological activities documented in the literature on the compounds found in this study