Measuring engagement of the executive control network from 3 months of age

The executive control network (ECN) is critical for higher cognition and executive function (EF). Despite its importance, no scientific consensus has been reached on how and when it begins to function. In the present study, we assessed the development of the ECN in awake infants less than a year old by employing functional magnetic resonance imaging (fMRI) and naturalistic stimuli. First, we identified evocative movies that engaged infant attention. We then transferred them into adult imaging to test for which movie evoked the highest ECN response. Strong ECN responses were evoked while viewing Despicable Me, therefore we implemented this movie into infant imaging. We found that as early as 3-months of age, infants showed a similar response to that of adults. Overall, we demonstrated a technique that could potentially gauge EF in very young infants and developed a tool capable of imaging awake infants under natural conditions

MicroRNAs in the Developing Ovine Kidney

INTRODUCTIONThe sudden loss of kidney function is known as acute kidney injury (AKI), and is referred to as pediatric AKI or pAKI in the neonate, infant, and child. Characterized clinically by a decrease in kidney filtration that can usually be reversed, as well as the inability of the kidney to appropriately regulate fluid and electrolyte homeostasis [1,2], pAKI can lead to serious complications in kidney function later in life, known as chronic kidney disease (CKD). To date, underlying factors involved in the etiology of pAKI are not known. MicroRNAs (miRNAs) are a class of functional single stranded non-coding, small ribonucleic acid molecules [3]. These post-transcriptional regulators modify the expression of genes by acting on the mRNA that is transcribed from a gene (or multiple mRNAs), and thus, affect the translation of encoded protein [3,4]. miRNAs have been implicated in the etiology of AKI in adult animals, but their role in pAKI is not known. This preliminary research aims to determine potential regulatory genes targeted by miRNAs in the developing ovine kidney, and to explore whether any of these genes are altered in an experimental model of pAKI.METHODSAnimals used were Ovies aries (sheep, ~15 to 20 days postnatal, sacrificed). Kidney tissues were harvested and snap frozen. Two tissues were evaluated: AKI [Treated with lipopolysaccharide (0.03 mg/kg) and Indomethacin (1 mg/kg)] and Control (Untreated).miRNA was extracted from both tissues using the mirVana miRNA Isolation Kit. Samples were sequenced in the ACHRI Genomes Facility. Using MicroCosm Targets genes/miRNAs were evaluated and plotted using Microsoft Excel. After generation of all genes, those with ≥1.5 fold change (AKI vs. Control) were selected for analyses. RESULTSA total of 103 miRNAs were present in Control and AKI tissue, in which the number of down-regulated genes (n=74) far exceeded the number up-regulated (n=27). A greater number of down-regulated genes exhibited ≥1.5-fold, ≥2.0-fold and ≥3.0 fold changes as compared to up-regulated genes. Oar-miR-380-3p_st (GGUGGAUAUUCCUUCUAUGUUU, fold-change = -2.1521) was found to be down-regulating the expression of cyclo-oxygenase (COX1, COX7C) and nitric oxide  (NOX1) genes.Table 1. MicroRNAs measured in ovine renal tissue. The number of genes down-regulated, up-regulated, and unchanged are shown as fold-change in AKI as compared to Control tissue.SUMMARY AND CONCLUSIONSThere were notable changes in miRNAs in AKI compared to Control tissue. Substantially fewer up-regulated genes than down-regulated genes, including COX1, COX7C, and NOX1 genes were observed (Table 1). Target genes within the COX and NOX pathways which are known to modulate kidney haemodynamics and function may reveal their altered roles in AKI. Given the evolutionary conservation of miRNA regulatory circuits [4,5], a subset of candidate miRNAs in ovine tissue could be identified and validated for application to pAKI in future studies. Through the successful application of miRNA analyses to establish regulatory genes in ovine kidney tissue, we may further our understanding of the causes and consequences of pAKI, the deleterious effects of pAKI on kidney function, and the progression from pAKI to CKD

Attachment styles and perceived parental acceptance and rejection of sexual orientation in LGBQ individuals

Individuals who identify as LGBQ can face challenges with social acceptance. This study seeks to measure the relationship between sexual orientation and attachment style, and how parental response to coming out as non-heterosexual might impact this relationship. Participants completed an online survey measuring adult attachment via the Experiences in Close Relationships-Revised (ECR-R) and perceived parental acceptance or rejection via the Parental Acceptance and Rejection of Sexual Orientation Scale (PARSOS). The authors posit that perceived parental acceptance serves as a protective factor for attachment insecurity and explore Emotionally Focused Therapy as a treatment to increase attachment security in LGBQ individuals

An Economic & Environmental Analysis of the JetBlue Airways Ground Support Vehicles: A Proposed Implementation of a Cleaner-Burning Fleet

JetBlue Airways Corporation, a Fortune 500 company based in New York City, is an airline that services 87 destinations across the U.S., Caribbean, and Latin America. From 2010 to 2014, JetBlue has made its overall operations increasingly more energy efficient, resulting in an 8.3% decline in greenhouse gas emissions intensity ratio (metric tons CO2-eq per 1,000 revenue ton miles flown), which has also saved the company millions of dollars in operating costs. As JetBlue continues to enhance its efforts to couple sustainability with economic value, a logical next step was to evaluate JetBlue’s ground fleet for potential improvement. Our analysis focused on ground support operations at JetBlue’s Terminal 5 at John F. Kennedy International Airport (JFK) in New York. Responsible for 13,800 metric tons of CO2-eq emissions, the function of ground support equipment (GSE) vehicles is to service the aircraft between flights. Our study included the three most used vehicle types—bag tug, belt loader, and push back tug—as they offered the largest opportunity for savings. Our study explored the economic and environmental opportunities associated with replacing current gasoline and diesel-powered GSE vehicles with electric vehicles, also called eGSE. This report first provides background on JetBlue Airways, its environmental impacts, and the airline’s sustainability program. It provides general emissions trends within the transportation sector before narrowing in on ground vehicles, where it details their specific function and describes emissions standards that apply to off-road GSE. The report then details the first step within our analysis in which we review JetBlue-provided GSE data, including a system-wide inventory and ground fuel expenditures dataset by airport. This report summarizes this data by describing the composition of JetBlue’s JFK ground vehicles by function, quantity, and energy inputs. We then consider energy reduction strategies for the GSE fleet by describing available alternative fuel sources and evaluating relevant efforts by other airlines and airports. The next stage of our analysis consisted of interviews with JetBlue employees and associated business partners and stakeholders, whose commentary and feedback have been integrated into the report. Data was also recorded on the ground at JFK to better understand the operation and retrieve accurate daily vehicle usage data. In the final stage of the analysis, all data was synthesized into a model that estimated how much gasoline or diesel the average bag tug, belt loader, and push back tug is using, as well as how much JetBlue spends per vehicle in powering it annually. Based off data from a GSE manufacturer, we calculated what the energy costs savings would be if all vehicles would run off of electricity instead of gasoline or diesel. Lastly, we modeled eight scenarios in which JetBlue would change a portion of their fleet to electric, and for each scenario the model projected fuel costs and emissions savings. Page | 2 Based on the incentives described in this report, we recommend the following for JetBlue’s GSE fleet at JFK: 1. Pursue push back electrification secondary to bag tug and belt loader 2. Launch pilot to test 1 charger, 2 belt loaders, and 1 bag tug at JFK 3. Apply for the FAA’s Voluntary Airport Low Emissions Program (VALE) funding 4. Set goal of 20% electric bag tugs and belt loaders in 3-year period (by 2019), replacing vehicles as they retire. In a worst case scenario where JetBlue receives no funding and pays the higher cost for all new vehicles instead of refurbished, JetBlue will save roughly $1.7 million and 36,500 metric tons of CO2-eq emissions across a 14-year timeline. 5. Set goal of 50$4.3 million and 89,200 metric tons of CO2-eq emissions across a 14-year timeline. 6. Research feasibility of retrofitting 100% electric belt loaders, bag tugs, and push backs, replacing vehicles are they retire. This can maximize the opportunity to save roughly $7 million in fuel costs (assuming funding is received) and over 60,000 metric tons of CO2-equivalent emissions over 14 years

Integrated semi-continuous manufacturing of lentiviral vectors

Please click Additional Files below to see the full abstract