Not Available

Not AvailableSeed is recognized to be the cheapest source, yet most critical single input for enhancing vegetable productivity. Use of good quality seeds can result in 15–20% yield increase. The Indian vegetable seed sector is established with tremendous potential to grow beyond boundaries of domestic market. Being high value per unit weight, vegetable seed segment has a significant share in the overall seed market in monetary terms. Although the price of vegetable seeds in market is very high, farmers are facing problem of spurious seed, low germination percentage and unavailability of quality seeds on time. Research and development interventions are required to overcome these problems and an effort has been made to identify the priority areas where interventions are required in vegetable seed sector. This study was undertaken during 2014-16 by conducting a survey of vegetable and seed experts in which major constraints in vegetable seed sector were identified. The constraints are rank ordered as perceived by the respondents like exorbitantly high price of private sector hybrids (Score-680, Rank-1), unavailability of quality seeds of recommended/released hybrids and OP varieties of vegetables (Score-658, Rank-2) and many more which have been discussed and will draw attention on the issues related to the vegetable seed sector which needs priority in further research.Not Availabl

Not Available

Not AvailableNot AvailableNot Availabl

Not Available

Not AvailableMajor vegetable growing areas in the eastern Indo-Gangetic plains of Uttar Pradesh were studied for the prevalence of tospoviruses over 5 years from 2015 to 2019. A total of 161 samples from 13 cultivated, one wild, and two weed species across five cropping seasons were carefully examined to identify the diversity and possible potential reservoirs of tospoviruses in the vegetable ecosystem. The results indicate that GBNV was mainly distributed in solanaceous crops, whereas WBNV in cucurbitaceous crops. Among weeds, datura and night shade were identified as an alternative host, which could have contributed to the epidemiology of tospovirus. In addition to some earlier reported hosts, WBNV in long melon was documented for the first time from India. Interestingly, GBNV and WBNV viruses were identified to co-infect bitter gourd plants. Phylogenetic analysis based on the N gene illustrated the monophyletic nature of GBNV and CaCV. In contrast, WBNV isolates were segregated into two diferent subclad comprising the northern and southern Indian isolates. Furthermore, cowpea seeds from infected plants were taken to determine GBNV infection’s ill-efects on seed quality. The study revealed germination percentage, seed weight, vigour index, percentage of abnormal seedlings, and seed yield per plant were significantly reduced in infected seeds compared to healthy ones. However, there was no significant difference in the speed of seed germination.Not Availabl

Breast cancer diagnosis model using stacked autoencoder with particle swarm optimization

Breast cancer (BrC) stands as the most prevalent cancer affecting women globally, comprising 24.5% of all female cancer diagnoses and contributing to 15.0% of total cancer-related fatalities. The timely detection and precise categorization of breast cancer play pivotal roles in enhancing patient prognosis and treatment outcomes. The main goal is to enhance the precision of classifying mammogram images, thus offering vital support to radiology experts in diagnosing BrCs. The proposed model encompasses several pivotal stages, including pre-processing, feature extraction, segmentation, and classification. To assess the model's efficacy, we employed the INBreast dataset. During pre-processing, mammogram images were enhanced through a customized contrast-limited adaptive histogram equalization (mCLAHE) technique coupled with data augmentation. Segmentation was executed utilizing the Res-SegNet model, and feature extraction employing the VGG-19 model. The classification was conducted via a stacked autoencoder (SAE) with particle swarm optimization (PSO). Our proposed model exhibited notably high performance compared to alternative models such as CNN, Yolo-v4, and Inception-v3. The results unveiled an accuracy of 98.33%, precision of 99.39%, recall of 98.78%, specificity of 93.75%, an F1-score of 99.08%, and an MCC score of 90.04%

Not available

Not AvailableHybrid seed production in sunflower is a challenging task. Pollen theft by pollinators is a problem in sunflower hybrid seed production. The male parent block is always covered with a net to avoid pollinator visits. Hence, manual pollination method was recommended for good seed set and higher seed yield in sunflower. During hand pollination, a shortage of pollen due to lack of synchronization between male and female parents and unfavourable weather conditions leads to poor seed set and low yield. The utilization of stored pollen grains is a viable option to ensure pollen availability during pollen scarcity periods. In this study, sunflower pollen grains were stored at room temperature (RT), earthen pot under the pit in the open field, refrigerator (5℃) and non-polar solvents (both in RT and 5℃) for up to seven days. The viability of stored pollen was tested every day both in the laboratory (staining method) and in field conditions (hand pollination method). The staining method used for testing pollen viability was modified and standardized in laboratory conditions because of non-satisfactory results observed in existing methods. The highest pollen viability was observed in dry pollen stored at 5℃ for up to 7 days. Pollen grains stored in hexane at 5℃ recorded viability and seed set up to 4 days. Dry pollen grain at room temperature and in an earthen pot remains viable for two days. Though the pollen grains stored in acetone (both RT and 5℃) was showing viability in staining methods for three days, it failed to set seeds in field conditions. Therefore, the dry pollen grains can be effectively stored at 5℃ and utilized for up to seven days in hybrid seed production of sunflower.Not Availabl

Not Available

Not AvailableBitter gourd (Momordica charantia L., family Cucurbitaceae) is a major vegetable crop widely cultivated throughout India. Bitter gourd pods are consumed for their nutritional and medicinal value. In 2016, nearly 15% of plants showed virus-like symptoms in a 0.6 ha bitter gourd farm at the Indian Institute of Vegetable Research, Varanasi, Uttar Pradesh, India. Symptomatic plants were stunted with necrosis of growing tips and yellowing and downward cupping of leaves that became thick and leathery in appearance. Because these symptoms were like those produced by orthotospoviruses in vegetable crops (Kunkalikar et al. 2011), leaves from five symptomatic and five nonsymptomatic plants were initially tested by indirect ELISA using polyclonal antibodies raised against Peanut bud necrosis virus (PBNV; genus, Orthotospovirus; family, Tospoviridae). These antibodies were obtained from the International Crops Research Institute for the Semi-Arid Tropics, Hyderabad, India. Only samples from symptomatic plants gave positive reaction, suggesting the presence of PBNV. Owing to cross-reactivity of PBNV polyclonal antibodies with Watermelon bud necrosis virus and Capsicum chlorosis virus, two orthotospoviruses infecting vegetables in India (Kunkalikar et al. 2011), additional molecular diagnostic assays were performed to confirm the presence of PBNV. For this purpose, total RNA was extracted from leaves of symptomatic and nonsymptomatic plants using TRIzol reagent (Ambion) and subjected to two-step reverse-transcription polymerase chain reaction (RT-PCR) to amplify a portion of the L RNA segment of orthotospoviruses using degenerate primers reported earlier (Chu et al. 2001). A DNA fragment of approximately 800 base pairs (bp) was amplified only from symptomatic samples. The amplicons were cloned into pTZ57R/T vector (Fermentas), and two clones per amplicon were sequenced in both orientations. The consensus nucleotide sequence (KY798419) showed 97% identity with the corresponding L RNA sequence of PBNV (AF025538), indicating the presence of PBNV in symptomatic plants. To further confirm these results, total RNA was subjected to RT-PCR using newly designed primer pairs GK PBNV F (5′ATGTCTAACGTYAAGCAGCTC3′) and GK PBNV R (5′TTACAATTCCAGCGAAGGAC3′) to amplify the nucleocapsid (N) gene encoded by S RNA and GK PBNV MP F (5′ATGTCTCGCTTGTCTAACG3′) and GK PBNV MP R (5′CAAGAAGATTATCCATCTC3′) to amplify the movement protein (NSm) gene encoded by M RNA of PBNV. The primer pair GK PBNV F and GK PBNV R amplified 830-bp DNA fragment specific to the N gene, and the primer pair GK PBNV MP F and GK PBNV MP R amplified 916-bp fragment specific to the NSm gene from all the five symptomatic samples. The amplicons were sequenced directly, and the derived nucleotide sequence for the N gene (KY798417) exhibited 99% identity with the corresponding sequence of PBNV (JX511967, JX524443, and JX524450), and the NSm gene nucleotide sequence (MF346701) showed 98% identity with the corresponding sequence of PBNV (JN662495, JX535589, and JX535585) reported previously from India. These results further confirmed the presence of PBNV in symptomatic bitter gourd leaves. Previously, PBNV was reported on watermelon from India (Kunkalikar et al. 2011). To our knowledge, this study represents the first report of natural PBNV infection of bitter gourd and suggests that PBNV may be more widely distributed in cucurbitaceous vegetable crops in India than previously thought.Not Availabl

Not Available

Not AvailableThe present study aims to understand the physiological and biochemical changes occurring in Moringa (Moringa oleifera Lam.) seeds from development to maturation. The flowers of ten uniform plants (1.5 years old) were first tagged, and the growth of the pod and seeds was monitored from 7 days after anthesis (DAA) to 70 DAA (maturity) during 2016-17 and 2017-18. Results showed that the moisture content of seeds increased significantly from 14 to 28 DAA. Following that, it decreased gradually from 28 to 49 DAA and drastically from 49 to 70 DAA. The dry weight of the seeds increased substantially until 70 DAA due to increase in carbohydrates, proteins, and oils in developing seed. Seeds acquired germinability at 49 DAA but attained desiccation tolerance only after 56 DAA. Seeds harvested at 70 DAA showed maximum germination, seedling length, seedling dry weight, vigor index-I, vigor index-II, and maximum dry weight. Thus, this stage could be considered as the most suitable stage for harvesting. Furthermore, high dehydrogenase activity and lower electrical conductivity with a decrease in total soluble sugars and total soluble proteins in seed leachate indicate higher vigour and better physiological status of the seed during the later stages of development and maturation. A proper understanding of seed maturity will boost seed-based cultivation, improve seed storability and germination percentage, reduce seed shattering, and promote commercial cultivation.Not Availabl

Not Available

Not AvailableMoringa oleifera Lam. is a fast–growing, soft wood, drought–resistant and multipurpose tree of Moringaceae family (Quattrocchi 2000), popularly known as drumstick in India and horseradish tree in other parts of the world. This miracle tree is native to India and cultivated in the tropics and sub–tropics of the world for its nutritional, medicinal and therapeutic properties (Nsofor et al. 2012). Propagation of moringa through seed is easy (Radovich 2012) and can be achieved in a large area rapidly when compared to stem cutting methods. Moringa seeds, not only used as planting material but are also a rich source of oil (ben–oil) (Anwar and Rashid 2007), which is considered as good substitute for Olive oil.Not Availabl

Not Available

Not AvailableInsect crop visitations do not necessarily always translate to transfer or carriage of pollen. To determine the potential of the various insects visiting summer and rainy seasons sponge gourd (Luffa cylindrica (Linn.)) flowers to facilitate the pollen transfer, the present study examines the diversity of visiting insects to sponge gourd seed crops in relation to the time of day and season, diversity and abundance to its flowers, fruits and seed yield. These visiting insects taxonomically belonged to 8 different insect orders viz. Coleoptera, Diptera, Hymenoptera, Hemiptera, Neuroptera, Lepidoptera, Odonata and Orthoptera/Dictyoptera. Rainy season sponge gourd crops had higher numbers of insect visitors and higher diversity 0.80 of Simpson’s Diversity Index and 1.71 of Shannon–Weaver Index of diversity as compared to summer season crop (0.72 and 1.51, respectively). The summer crop had the highest number of visiting insects belonged to the order Coleoptera followed by Hemiptera and Hymenoptera and their reciprocal form of Berger Parker’s dominance indices were 2.21, 5.05 and 6.17, respectively. In summer crop, honeybees were the main pollinators comprising 57.69% of total pollinators in sponge gourds. All the four honeybee species viz., Apis cerana indica, A. dorsata, A. florea and A. mellifera were found to visit in sponge gourd. However, the dominant species was A. florea with 39% of total honeybee share. In rainy season crop, in contrary, honeybees comprised only 16.32% share on total visiting pollinators in sponge gourd. Rice skipper, Pelopidas mathias (46.84% share) was found almost thorough out the day with higher visitation during evening hours. Other pollinators were stingless bees (11.58% share), butterflies and moths. Consequently, we suggest optimizing pollinators’ management including honeybees and thereby improving the attraction of sponge gourd lines to these pollinators to improve pollination rates for sponge gourd seed crops.Not Availabl