Fluorescence Sensing Using DNA Aptamers in Cancer Research and Clinical Diagnostics

Among the various advantages of aptamers over antibodies, remarkable is their ability to tolerate a large number of chemical modifications within their backbone or at the termini without losing significant activity. Indeed, aptamers can be easily equipped with a wide variety of reporter groups or coupled to different carriers, nanoparticles, or other biomolecules, thus producing valuable molecular recognition tools effective for diagnostic and therapeutic purposes. This review reports an updated overview on fluorescent DNA aptamers, designed to recognize significant cancer biomarkers both in soluble or membrane-bound form. In many examples, the aptamer secondary structure switches induced by target recognition are suitably translated in a detectable fluorescent signal using either fluorescently-labelled or label-free aptamers. The fluorescence emission changes, producing an enhancement ("signal-on") or a quenching ("signal-off") effect, directly reflect the extent of the binding, thereby allowing for quantitative determination of the target in bioanalytical assays. Furthermore, several aptamers conjugated to fluorescent probes proved to be effective for applications in tumour diagnosis and intraoperative surgery, producing tumour-type specific, non-invasive in vivo imaging tools for cancer pre- and post-treatment assessment

Anticancer Ruthenium(III) Complexes and Ru(III)-Containing Nanoformulations: An Update on the Mechanism of Action and Biological Activity

The great advances in the studies on metal complexes for the treatment of different cancer forms, starting from the pioneering works on platinum derivatives, have fostered an increasingly growing interest in their properties and biomedical applications. Among the various metal-containing drugs investigated thus far, ruthenium(III) complexes have emerged for their selective cytotoxic activity in vitro and promising anticancer properties in vivo, also leading to a few candidates in advanced clinical trials. Aiming at addressing the solubility, stability and cellular uptake issues of low molecular weight Ru(III)-based compounds, some research groups have proposed the development of suitable drug delivery systems (e.g., taking advantage of nanoparticles, liposomes, etc.) able to enhance their activity compared to the naked drugs. This review highlights the unique role of Ru(III) complexes in the current panorama of anticancer agents, with particular emphasis on Ru-containing nanoformulations based on the incorporation of the Ru(III) complexes into suitable nanocarriers in order to enhance their bioavailability and pharmacokinetic properties. Preclinical evaluation of these nanoaggregates is discussed with a special focus on the investigation of their mechanism of action at a molecular level, highlighting their pharmacological potential in tumour disease models and value for biomedical applications

Guanine-based amphiphiles: synthesis, ion transport properties and biological activity

Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Trifunctionalized Naphthalene Diimides and Dimeric Analogues as G-Quadruplex-Targeting Anticancer Agents Selected by Affinity Chromatography

A focused library of newly designed monomeric and dimeric naphthalene diimides (NDIs) was analyzed in its ability to recognize specific G-quadruplex (G4) structures discriminating duplex DNA. The best G4 ligands—according to an affinity chromatography-based screening method named G4-CPG—were tested on human cancer and healthy cells, inducing DNA damage at telomeres, and in parallel, showing selective antiproliferative activity on HeLa cancer cells with IC50 values in the low nanomolar range. CD and fluorescence spectroscopy studies allowed detailed investigation of the interaction in solution with different G4 and duplex DNA models of the most promising NDI of the series, as determined by combining the biophysical and biological assays’ data

8-CF3-2’-deoxyguanosine as a useful nucleoside analog for 19F NMR-based structural studies of G-quadruplex structures

Herein, a synthetic study to obtain a 2’-deoxyguanosine derivative carrying the CF3 group on the nucleobase is reported. Key reaction to obtain this building block is the trifluoromethylation step, carried out on 3’,5’-di-O-acetyl-2’-deoxyguanosine using CF3SO2Na and tert-butylhydroperoxide in a biphasic system, adapted from a recently published protocol to obtain CF3-derivatized aromatic heterocycles

Secosteroids of marine origin

This review describes the isolation from marine organisms of all secosteroids reported in the literature from 1972 to 2004. Secosteroids are highly oxidized metabolites with bond cleavage in the rings of the steroid tetracyclic nucleus. All secosteroids are grouped in accordance with their ring joined to side chain as 5,6-, 9,11-, 9,10- 8,9-, 8,14- and 13,17-secosteroids and the structures and the synthetic works, where available, are reported. Furthermore, this review gives details on the biological activities of the isolated secosteroids (e.g. antiproliferative, antifouling, antiinflammatory, antimicrobial, ichthyotoxic and antiviral)

Design, Synthesis, and Characterization of an Amphiphilic Lipoic Acid-Based Ru(III) Complex as a Versatile Tool for the Functionalization of Different Nanosystems

Ru-based chemotherapy is emerging as an effective alternative to the well-established Pt-based one, typically associated with high toxicity. In this context, our recent efforts were devoted to the preparation of nucleolipid-based Ru(III) complexes able to form, under physiological conditions, supramolecular aggregates which can efficiently prevent metal deactivation and convey Ru(III) inside the cells where it exerts its activity. Within an interdisciplinary program for the development of multifunctional nanoparticles for theranostic applications, we here report the design, synthesis, and characterization of a novel functionalized Ru(III) salt, carrying a lipoic acid moiety in the nucleolipid-based scaffold to allow its incorporation onto metal-based nanoparticles

CH3ReO3-catalyzed oxidation of cholesta-5,7-dien-3beta-yl acetate with the urea-hydrogen peroxide adduct under various conditions. Synthesis of the natural epoxy sterol 9α,11α-epoxy-5α-cholest-7-en-3β,5,6β-triol

This article describes the oxidation of cholesta-5,7-dien-3β-yl acetate (4) with the urea-hydrogen peroxide adduct (UHP) using methyltrioxorhenium (MTO) as catalyst, under various conditions. Specifically, the effects of using different solvents (CHCl3 and ethers) and additives (EtOH and pyridine) on the course of the MTO-catalyzed oxidation of 4 were investigated. Some new steroids (6, 9, 10 and 11), obtained from this oxidation, were isolated and characterized on the basis of chemical evidence and interpretation of spectroscopic data including H-H COSY and HMBC experiments. The optimal solvent for the oxidation of 4 with MTO/UHP oxidizing system was diethyl ether. In this solvent the reaction is clean and gave as the main product 5,6β-dihydroxy-5α-cholest-7-en-3β-yl acetate (8, 65% yield), obtained with a more simple procedure and with a higher yield than that reported in literature. Sterol 8 is a key intermediate compound in the synthesis of many steroids of marine origin, biologically active, oxygenated at the B/C rings. In fact, starting from diol 8, we performed the synthesis of the natural cytotoxic epoxy sterol 9α,11α-epoxy-5α-cholest-7-en-3β,5,6β-triol (15, 21% yield) with an improvement in yield and number of steps over a synthesis of the same natural product previously reported. When the oxidation of 4 with the MTO/UHP system in diethyl ether was performed in the presence of pyridine as ligand, the unsaturated epoxide 5,6α-epoxy-5α-cholest-7-en-3β-yl acetate (10, 90% yield) was obtained after only 5 min in good yield. In fact, pyridine, besides having beneficial effect on the reaction rate, shuts down the ring opening reactions, as reported in literature

Fluorine-containing nucleosides for 19F NMR-based structural studies of nucleic acids: synthesis and characterization of 8-CF3-2’-deoxyguanosine

Aiming at the preparation of 19F-labelled monomers, allowing to exploit 19F nuclei as probes for NMR studies on nucleic acids, and particularly G-quadruples structures, we focused our attention on the unprecedented 8-CF3 analog of 2’-deoxyguanosine. CF3 is an isostere of CH3. The presence of a CH3 group at C-8 favors the sin conformation of the guanine with respect to the N-glycosidic bond. Tagging this position with a CF3 group is expected to produce similar effects, and thus to stabilize/destabilize a G-quadruplex structure in a predictable manner, in addition providing a selective probe to detect 1H-19F correlations useful in the assignment of spatially close residues. We here describe a synthetic study to obtain a 2’-deoxyguanosine derivative carrying a CF3 residue on the nucleobase. Key reaction to obtain this building block is the trifluoromethylation, carried out on 3’,5’-di-O-acetyl-2’-deoxyguanosine using CF3SO2Na and tert-butylhydroperoxide in a biphasic system, adapted from a recently published protocol to obtain CF3-derivatized aromatic heterocycles