1,112 research outputs found
Las Reparaciones En El Sistema Interamericana De Proteccion De Derechos Humanos
Los tribunales internacionales en general, tienen como parte de su competenia poner termino a los conflictos que se les presenten por parte de los sujetos con capacidad legal para accionar ante ellos mediante la emision de una sentencia o fallo
The asymmetric profile of the H76 alpha line emission from MWC349
MWC349 is an emission-line star found by Merrill, Humason and Burwell (1932). Braes, Habing and Schoenmaker (1972) discovered that it is a strong radio source. The radio emission originates in a massive ionized wind that is expanding with a velocity of about 50 km s(-1). Its continuum spectrum fits well a nu(0.6) power law from the cm wavelengths to the far-IR. Radio recombination line emission from the envelope of MWC349 was first detected by Altenhoff, Strittmatter and Wendker (1981). We have obtained good signal-to-noise ratio, Very Large Array observations of the H76 alpha radio recombination line from the ionized wind of MWC349. Our data reveal that the profile is markedly asymmetric, with a steep rise on the blue side. This asymmetry could be due to non-LTE effects in the formation and transfer of the line or to intrinsic asymmetries in the envelope. Our analysis suggests that most probably the peculiar profile is caused by a non-LTE enhancement of the line emission from the side of the envelope nearer to the observer. This asymmetry has the opposite sense than that observed in optical and IR recombination lines, where a different effect (absorption of the stellar continuum by the gas in the wind between the star and the observer) is known to be dominant, leading to the classic P Cygni profile. We propose that the profiles of the radio recombination lines from ionized stellar winds will have this characteristic shape, while optical and IR recombination lines are characterized by P Cygni-like profiles. Unfortunately, at present the detection of radio recombination lines from ionized stellar winds is only feasible for MWC349 and a few other objects
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
Stereomicroscope Inspection of Polished Aluminum Collector 50684.0
The Genesis polished aluminum "kidney" collector was damaged during the hard landing of the capsule on September 8, 2004 in the Utah desert. The kidney was introduced into the Genesis (ISO class 4) cleanroom laboratory on November 4, 2004 and stored under nitrogen cover gas. The collector is currently fastened to a highly polished stainless steel plate for secure handling. Curatorial work at JSC has made successful subdivision and subsequent allocation of samples from the kidney
Genesis Concentrator Target Particle Contamination Mapping and Material Identification
The majority of surface particles were found to be < 5 microns in diameter with increasing numbers close to the optical resolution limit of 0.3 microns. Acceleration grid EDS results show that the majority of materials appear to be from the SRC shell and SLA materials which include carbon-carbon fibers and Si-rich microspheres in a possible silicone binder. Other major debris material from the SRC included white paint, kapton, collector array fragments, and Al. Image analysis also revealed that SRC materials were also found mixed with the Utah mud and salt deposits. The EDS analysis of the acceleration grid showed that particles < 1 m where generally carbon based particles. Chemical cleaning techniques with Xylene and HF in an ultrasonic bath are currently being investigated for removal of small particles by the Genesis science team as well as ultra-pure water megasonic cleaning by the JSC team [4]. Removal of organic contamination from target materials is also being investigated by the science team with the use of UV-ozone cleaning devices at JSC and Open University [5]. In preparation for solar wind oxygen analyses at UCLA and Open University [1, 2], surface particle contamination on three Genesis concentrator targets was closely examined to evaluate cleaning strategies. Two silicon carbide (Genesis sample # 60001 and 60003) and one chemical vapor deposited (CVD) 13C concentrator target (60002) were imaged and mosaic mapped with optical microscopes. The resulting full target mosaic images and particle feature maps were subsequently compared with non-flight, but flight-like, concentrator targets and sample return capsule (SRC) materials. Contamination found on the flown concentrator acceleration grid was further examined using a scanning electron microscope (SEM). Energy dispersive X-ray spectroscopy (EDS) for particle identification was subsequently compared with the optical images from the flown targets. Figure 1 show that all three targets imaged in this report are fully intact and do not show any signs of material fractures. However, previous ellipsometry results and overview imaging of both flown SiC targets show a solar wind irradiation gradient from the center focal point to the outer edge [3]. In addition, due to the hard landing, each target has experienced varying degrees of impacts, scratches, and particle debris from the spacecraft and Utah impact site
Genesis Silicon Carbide Concentrator Target 60003 Preliminary Ellipsometry Mapping Results
The Genesis concentrator was custom designed to focus solar wind ions primarily for terrestrial isotopic analysis of O-17/O-16 and O-18/O-16 to +/-1%, N-15/N-14 to +/-1%, and secondarily to conduct elemental and isotopic analysis of Li, Be, and B. The circular 6.2 cm diameter concentrator target holder was comprised of four quadrants of highly pure semiconductor materials that included one amorphous diamond-like carbon, one C-13 diamond, and two silicon carbide (SiC). The amorphous diamond-like carbon quadrant was fractured upon impact at Utah Test and Training Range (UTTR), but the remaining three quadrants survived fully intact and all four quadrants hold an important collection of solar wind. The quadrants were removed from the target holder at NASA Johnso n Space Center Genesis Curation Laboratory in April 2005, and have been housed in stainless steel containers under continual nitrogen purge since time of disintegration. In preparation for allocation of a silicon carbide target for oxygen isotope analyses at UCLA, the two SiC targets were photographed for preliminary inspection of macro particle contamination from the hard non-nominal landing as well as characterized by spectroscopic ellipsometry to evaluate thin film contamination. This report is focused on Genesis SiC target sample number 60003
Preliminary Quantification of Image Color Gradient on Genesis Concentrator Silicon Carbine Target 60001
The Genesis spacecraft concentrator was a device to focus solar wind ions onto a 6-cm diameter target area, thus concentrating the solar wind by 20X [1]. The target area was comprised of 4 quadrants held in place by a gold-coated stainless steel "cross" (Fig. 1). To date, two SiC and one chemical vapor deposited (CVD) quadrants have been imaged at 5X using a Leica DM-6000M in autoscan mode. Complete imaging of SiC sample 60001 required 1036 images. The mosaic of images is shown in Fig. 2 and position of analyzed areas in Fig. 3. This mosaic imaging is part of the curatorial documentation of surface condition and mapping of contamination. Higher magnification (50X) images of selected areas of the target and individual contaminant particles are compiled into reports which may be requested from the Genesis Curator [2]
Demonstration of Hazardous Hypervelocity Test Capability
NASA Johnson Space Center (JSC) White Sands Test Facility (WSTF) participated in a joint test program with NASA JSC Hypervelocity Impact Research Laboratory (HIRL) to determine if JSC was capable of performing hypervelocity impact tests on hazardous targets. Seven pressurized vessels were evaluated under hypervelocity impact conditions. The vessels were tested with various combinations of liquids and gasses at various pressures. Results from the evaluation showed that vessels containing 100-percent pressurized gas sustained more severe damage and had a higher potential for damaging nearby equipment, than vessels containing 75-percent liquid, 25-percent inert pressurized gas. Two water-filled test vessels, one of which was placed behind an aluminum shield, failed by bulging and splitting open at the impact point; pressure was relieved without the vessel fragmenting or sustaining internal damage. An additional water-filled test vessel, placed a greater distance behind an aluminum shield, sustained damage that resembled a shotgun blast, but did not bulge or split open; again, pressure was relieved without the vessel fragmenting. Two test vessels containing volatile liquids (nitro methane and hydrazine) also failed by bulging and splitting open; neither liquid detonated under hypervelocity test conditions. A test vessel containing nitrogen gas failed by relieving pressure through a circular entry hole; multiple small penetrations opposite the point of entry provided high velocity target debris to surrounding objects. A high-pressure oxygen test vessel fragmented upon impact; the ensuing fire and high velocity fragments caused secondary damage to surrounding objects. The results from the evaluation of the pressurized vessels indicated that JSC is capable of performing hypervelocity impact tests on hazardous targets
Surface Acoustic Wave Single-Electron Interferometry
We propose an experiment to observe interference of a single electron as it
is transported along two parallel quasi-one-dimensional channels trapped in a
single minimum of a travelling periodic electric field. The experimental device
is a modification of the surface acoustic wave (SAW) based quantum processor.
Interference is achieved by creating a superposition of spatial wavefunctions
between the two channels and inducing a relative phase shift via either a
transverse electric field or a magnetic field. The interference can be used to
estimate the decoherence time of an electron in this type of solid-state
device
Gamma Ray Burst Neutrinos Probing Quantum Gravity
Very high energy, short wavelength, neutrinos may interact with the
space-time foam predicted by theories of quantum gravity. They would propagate
like light through a crystal lattice and be delayed, with the delay depending
on the energy. This will appear to the observer as a violation of Lorenz
invariance. Back of the envelope calculations imply that observations of
neutrinos produced by gamma ray bursts may reach Planck-scale sensitivity. We
revisit the problem considering two essential complications: the imprecise
timing of the neutrinos associated with their poorly understood production
mechanism in the source and the indirect nature of their energy measurement
made by high energy neutrino telescopes.Comment: 14 pages, 2 figure
- …