Morphology and morphometry of adult nematodes on Sumatran elephants (Elephas maximus sumatranus) in Way Kambas National Park area, Indonesia

Background and Aim: Worms from nematodes are the most numerous and the most detrimental in elephants. Most adult worms are located in the digestive tract. Nematode infection is at higher risk in young elephants, which caused several cases such as anemia, hypoalbuminemia, enteritis, and even death. This study aimed to determine the morphology and morphometry of adult nematodes on Sumatran elephants in Way Kambas National Park area. Materials and Methods: Nematode samples were obtained from Sumatran elephants' feces (Elephas maximus sumatranus) in Way Kambas National Park, Lampung Province, after being given Kalbazen® containing albendazole 1000 mg at a dose of 10 mg/kg by the veterinarian in charge of the National Park area. For the morphological and morphometric examinations, we used an Olympus BX 51 microscope equipped with Olympus DP 12 camera and were conducted at the Parasitology Laboratory, Faculty of Veterinary Medicine, Universitas Gadjah Mada. The scanning electron microscopic (SEM) analysis was carried out at the Biology Research Center of the Indonesian Institute of Sciences (Lembaga Ilmu Pengetahuan Indonesia). Results: The results of macroscopic observations of the obtained nematodes showed that the nematodes which were found have the characteristics of round, slim, and white color. The size of a female worm was larger than a male worm. Microscopic examination in four anterior papillae indicated that the dorsal lobe in the copulatory bursa was longer than lateral lobe. The result of inspection with the SEM showed a leaf crown consisting of 10 elements, a pair of amphids laterally, and two pairs of papilla in a submedian region. Conclusion: Based on our morphology and morphometry examinations of adult nematodes in Sumatran elephant (E. maximus sumatranus) in Way Kambas National Park area, the adult nematodes which were found are species of Quilonia travancra

Molecular Detection of Eimeria bovis in Indonesian Beef Cattle Using Nested PCR Technique

Eimeria bovis is a pathogenic protozoan that causes cattle digestive tract infections, which can cause economic losses to farmers. It is necessary to develop specific and accurate detection methods to conserve livestock and prevent coccidiosis in Indonesia. This study aims to detect E. bovis by nested PCR and determine the relationship with reference sequences. A total of 167 samples of beef cattle feces were taken randomly from community farms spread across 18 provinces in Indonesia. The feces were examined natively, and then the oocysts were purified by the sugar flotation method, extracted by KIT extraction, and amplified by the nPCR technique. Positive samples were followed by sequencing and phylogenetic analysis using MEGA 11 software. This study used two pairs of primers (outer and inner) taken from ITS-1 molecular markers. As many as 96 out of 167 samples (57.5%) were positive for Eimeria spp., and 48 of the 96 samples were positive for Eimeria spp. (50%) were detected to be positive for E. bovis based on the presence of a 238 bp DNA fragment. The results of the phylogenetic analysis showed that the study sample formed a separate cluster from the E. bovis cluster from abroad. In conclusion, E. bovis was detected in 16 out of 18 provinces in this study, and the nPCR technique proved to have better sensitivity and specificity

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed

Lice infestation and diversity in turkeys (Meleagris gallopavo) in the Special Region of Yogyakarta and Central Java, Indonesia

Background and Aim: Biting lice (Phthiraptera: Amblycera and Ischnocera) are ectoparasites that play important roles in the transmission of disease agents that infect turkeys and impact turkey productivity. This study aimed to determine the diversity of lice that infest turkeys in the Central Java Province and the Special Region of Yogyakarta, Indonesia. Materials and Methods: Lice sampling was conducted at 16 different locations from April 2019 to June 2019 in turkeys aged 4 months to 2 years. The samples were stored in 70% alcohol and were identified using avian louse keys. The morphology of the specimens was macroscopically and microscopically evaluated, and the resulting data were descriptively and qualitatively analyzed. Results: A total of 2505 lice were collected, and two families and five genera of lice were identified. Three lice genus members of the Philopteridae family (Lipeurus, Oxylipeurus, and Chelopistes) and two genera of the Menoponidae family (Colpocephalum and Menacanthus) were identified. Lipeurus was the most frequently identified genera in turkeys, whereas Menacanthus was the most rarely identified one. The White Holland breed had the highest number of lice infestations, whereas the Jersey Buff breed exhibited the highest diversity of lice genera. The average number of lice infestations was higher in male turkeys than in female turkeys. Conclusion: The occurrence of ectoparasites in domestic turkeys indicates that the existence and diversity of lice genera in the study location can be influenced by turkey type, turkey maintenance system, enclosure sanitation measures, lack of strategic ectoparasite control, and environmental factors

Morphological and molecular identification of Pfenderius heterocaeca (Trematode: Paramphistomoidea) from Sumatran elephant (Elephas maximus sumatranus)

Background and Aim: Paramphistomiasis is common in tropical countries such as Indonesia and affects livestock and various endemic wild animals such as Sumatran elephants. However, the specific species of paramphistomoid worm that causes paramphistomiasis are rarely reported. The study aims at identifying paramphistomoid worm that infects Sumatran elephants. Materials and Methods: Flukes were collected from the feces of five semi-captive Sumatran elephants that lived at Tegal Yoso Elephant Response Unit in Way Kambas National Park, in 2018, after treatment of oxyclozanide 1 g at the dose of approximately 5-8 mg/kg of body weight. Eight paramphistomoid worms were flattened and stained in Semichon's carmine for morphological identification, and five other worms were used for molecular identification at second internal transcribed spacer (ITS-2) of ribosomal deoxyribonucleic acid sequence. Results: Forty-five flukes were collected from five Sumatran elephants in Lampung, Indonesia. Eight paramphistomoid worms were morphologically identified as Pfenderius heterocaeca> and five isolates did not show any variation in ITS-2. Phylogenetic analysis showed that there was a close genetic relationship between our sample and Chiorchis fabaceus that had a family similar to the samples. Conclusion: Based on the morphological and molecular characteristics, the paramphistomoids found in Sumatran elephant on Way Kambas National Park are P. heterocaeca