トレーサブル超精密寸法測定に関する研究

要約のみTohoku University高偉課

High throughput molecular confirmation of β-thalassemia mutations using novel TaqMan probes

β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 “blinded” DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population

Plasma and urine metabolite profiling reveals the protective effect of Clinacanthus nutans in an ovalbumin-induced anaphylaxis model: ¹H-NMR metabolomics approach

The present study sought to identify the key biomarkers and pathways involved in the induction of allergic sensitization to ovalbumin and to elucidate the potential anti-anaphylaxis property of Clinacanthus nutans (Burm. f.) Lindau water leaf extract, a Southeast Asia herb in an in vivo ovalbumin-induced active systemic anaphylaxis model evaluated by 1H-NMR metabolomics. The results revealed that carbohydrate metabolism (glucose, myo-inositol, galactarate) and lipid metabolism (glycerol, choline, sn-glycero-3-phosphocholine) are the key requisites for the induction of anaphylaxis reaction. Sensitized rats treated with 2000 mg/kg bw C. nutans extract before ovalbumin challenge showed a positive correlation with the normal group and was negatively related to the induced group. Further 1H-NMR analysis in complement with Kyoto Encyclopedia of Genes and Genomes (KEGG) reveals the protective effect of C. nutans extract against ovalbumin-induced anaphylaxis through the down-regulation of lipid metabolism (choline, sn-glycero-3-phosphocholine), carbohydrate and signal transduction system (glucose, myo-inositol, galactarate) and up-regulation of citrate cycle intermediates (citrate, 2-oxoglutarate, succinate), propanoate metabolism (1,2-propanediol), amino acid metabolism (betaine, N,N-dimethylglycine, methylguanidine, valine) and nucleotide metabolism (malonate, allantoin). In summary, this study reports for the first time, C. nutans water extract is a potential anti-anaphylactic agent and 1H-NMR metabolomics is a great alternative analytical tool to explicate the mechanism of action of anaphylaxis

Molecular characterisation of β-globin gene mutations in Penang and Kedah, Malaysia

Introduction: Beta-thalassaemia is an autosomal recessive disorder and it is a public health problem in the Malaysian Malays and Chinese. This disorder mainly results from point mutations, small insertion or deletions in the β-globin gene complex. Beta-thalassaemia major patients require life-long monthly blood transfusions and iron-chelation therapies to sustain their lives. Mutation characterisation is necessary for affected couples at risk of having a β-thalassaemia major child. Objective: 1. To develop the TaqMan genotyping platform as a time- and cost-effective approach for characterisation of β-globin gene mutations. 2. To characterise the mutations using the developed assays in transfusion-dependent patients in Penang and Kedah. Methods: Ten sets of primers and TaqMan probes were designed to identify the common mutations in Malaysian Malays and Chinese: −28 (A→G), CD17 (A→T), CD19 (A→G), HbE (G→A), IVS1-1 (G→T), IVS1-5 (G→C), CD 41/42 (-CTTT), CD71/72 (+A), IVS2-654 (C→T) and Poly A (AATAAAHAATAGA). Another 7 sets of TaqMan genotyping assays were designed to identify the rare mutations in Malays and Chinese: −29 (A→G), Cap (+1) (A→C), CD8/9 (+G), CD16 (-C), CD27/28 (+C), IVS1-1 (G→A) and CD43 (G→T). The developed assays were used to screen 54 and 62 transfusion-dependent patients in Penang and Kedah respectively. Results & Discussion: The developed assays detected 92.9% of mutations in the β-thalassaemia major patients. The remaining mutations were detected by ARMS, gap-PCR and DNA sequencing. The most common mutation in β-thalassaemia major patients in Penang is CD41/42 with a frequency of 20.9%. The most common mutation in β-thalassaemia major patients in Kedah is HbE with a frequency of 30.8%. Conclusion: The simplicity and reproducibility of the TaqMan genotyping assays enable rapid and cost-effective analysis of the β-globin gene mutations in Malaysia

Hematological, biochemical, histopathological and 1H-NMR metabolomics application in acute toxicity evaluation of clinacanthus nutans water leaf extract

The present study aims for the first time to provide the in vivo acute toxicological profile of the highest dose of Clinacanthus nutans (Burm. f.) Lindau water leaf extract according to the Organization for economic co-operation and development (OECD) 423 guidelines through conventional toxicity and advanced proton nuclear magnetic resonance (1H-NMR) serum and urinary metabolomics evaluation methods. A single dose of 5000 mg/kg bw of C. nutans water extract was administered to Sprague Dawley rats, and they were observed for 14 days. Conventional toxicity evaluation methods (physical observation, body and organ weight, food and water consumption, hematology, biochemical testing and histopathological analysis) suggested no abnormal toxicity signs. Serum 1H-NMR metabolome revealed no significant metabolic difference between untreated and treated groups. Urinary 1H-NMR analysis, on the other hand, revealed alteration in carbohydrate metabolism, energy metabolism and amino acid metabolism in extract-treated rats after 2 h of extract administration, but the metabolic expression collected after 24 h and at Day 5, Day 10 and Day 15 indicated that the extract-treated rats did not accumulate any toxicity biomarkers. Importantly, the outcomes further suggest that single oral administration of up to 5000 mg/kg bw of C. nutans water leaf extract is safe for consumption

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations

Mediator Acts Upstream of the Transcriptional Activator Gal4

We show that Mediator, a protein originally isolated on the basis of its ability to respond to transcriptional activators, and thought to be regulated by an activator, can also be the master that controls the activator

Investigation on migration of LNAPL and DNAPL in different sand size layers

Soil contamination can be caused by any hazardous liquid, but namely hydrocarbons, which may be spilled or buried directly in the soil or migrate to the soil from elsewhere. When soil contamination occurs, it will cause groundwater pollution as well due to the movement of contaminants in the soil. The contaminants studied in this project are commonly referred to as non-aqueous phase liquids (NAPLs), which will dissolve slightly in water. Therefore, it is important to study the migration of NAPLs in soil. The main objective of this research is to investigate the migration of two different NAPLs in different sand size layers. Two types of NAPLs were used, which are toluene and trichloroethylene. Four different sizes of sand were used, which are 1.18 mm, 0.60 mm, 0.30 mm and 0.15 mm. Each NAPL was poured into the acrylic model after the preparation of the sand sample was ready. A digital camera was used to capture the images and Image-Pro software was used to process the data needed. The migrations of both NAPLs were analyzed through the image captured and data processed from the image software. From the experimental work, it showed that the time taken for the migration of NAPL is affected by the pore size in the sand layer. The percent area of NAPL migration can be generated by the imaging software. The percent area also can be affected by several characteristics such as interfacial tension, capillary pressure, gravitational force and density of NAPL with the interaction with pore sizes in sand layer. Other than that, the migration of NAPL will flow through the pathway with least resistance and does not have equal spreading in the sand layer

INVESTIGATION AND COMPARATIVE STUDIES OF PIPERACEAE PLANTS

Bachelor'sBACHELOR OF SCIENCE (HONOURS