The SNAT4 isoform of the system A amino acid transporter is functional in human placental microvillous plasma membrane

Placental system A activity is important for the supply of neutral amino acids needed for fetal growth. There are three system A isoforms: SNAT1, SNAT2 and SNAT4, but the contribution of each to system A-mediated transport is unknown. Here, we have used immunohistochemistry to demonstrate that all three isoforms are present in the syncytiotrophoblast suggesting each plays a role in amino acid transport across the placenta. We next tested the hypothesis that the SNAT4 isoform is functional in microvillous plasma membrane vesicles (MVM) from normal human placenta using a method which exploits the unique property of SNAT4 to transport both cationic amino acids as well as the system A-specific substrate MeAIB. The data show that SNAT4 contribution to system A-specific amino acid transport across MVM is higher in first trimester placenta compared to term (approx. 70% and 33%, respectively, P < 0.01). Further experiments performed under more physiological conditions using intact placental villous fragments suggest a contribution of SNAT4 to system A activity in first trimester placenta but minimal contribution at term. In agreement, Western blotting revealed that SNAT4 protein expression is higher in first trimester MVM compared to term (P < 0.05). This study provides the first evidence of SNAT4 activity in human placenta and demonstrates the contribution of SNAT4 to system A-mediated transport decreases between first trimester and term: our data lead us to speculate that at later stages of gestation SNAT1 and/or SNAT2 are more important for the supply of amino acids required for normal fetal growth

The retinoic acid and retinoid X receptors are differentially expressed during myoblast differentiation

Retinoids (all trans and 9-cis retinoic acid) are pleiotropic regulators of cell fate, and have been shown to regulate the expression of helix loop helix transcription factors (e.g MyoD, myogenin and Myf-5) that control myogenic differentiation. The effects of retinoids are mediated through the ligand dependant retinoic acid receptors (RARs) and retinoid X receptors (RXRs). We have found that the messenger RNA transcripts encoding RAR are repressed during differentiation of C2C12 myoblasts while, conversely, RXR mRNA transcripts are induced in C2C12 myotubes. These results imply that RXRs, play a major regulatory role in differentiated muscle

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone

Sequence and expression of Sox-18 encoding a new HMG-box transcription factor

The newly identified Sox gene family (Sry-like HMG-box gene) is characterized by a conserved DNA sequence encoding a domain of approx. 80 amino acids (aa) which is responsible for sequence-specific DNA binding. The first member isolated, the mammalian Y-linked testis-determining gene, Sry, is necessary and sufficient for male development. We report here the identification of two new members of this family, Sox-17 and 18. We have determined the full cDNA sequence of Sox-18 which encodes a protein of 378 aa. Sox-18 mRNA transcripts were restricted to heart, lung and skeletal muscle in the adult mouse

Exclusion of expansion of 50 CAG/CTG trinucleotide repeats in bipolar disorder

OBJECTIVE: The purpose of this study was to identify the specific expanded CAG/CTG trinucleotide repeat associated with bipolar disorder. METHOD: The study employed an efficient multistage approach for using a genomic CAG/CTG screening set. RESULTS: The authors found no evidence of expanded repeats at 43 polymorphic autosomal loci and seven X chromosomal loci. Secondary screening was pursued at the only locus that contained a large allele (37 repeats) in the primary screening. No association was found between allele size and diagnostic status. CONCLUSIONS: It is highly unlikely that expansions in repeat size at any of the 50 candidate trinucleotide repeat loci examined are responsible for the association between expanded CAG/ CTG repeats and bipolar disorder. However, although the authors prioritized the repeats that were a priori most likely to be involved, the study does not reject the more general hypothesis that expanded CAG/CTG repeats are implicated in the pathogenesis of bipolar disorder

Expanded CAG/CTG repeats in bipolar disorder: no correlation with phenotypic measures of illness severity

The hypothesis that expanded trinucleotide repeats (TNRs) contribute to the pathogenesis of bipolar disorder has received strong support from recent studies showing that, on average, bipolar patients carry larger repeat sequences of the TNR motif CAG/CTG than do controls. It has been postulated that intergenerational expansion of a TNR may be responsible for the tendency for age of onset to become earlier in younger generations (anticipation) observed in some bipolar pedigrees, and that length polymorphism may account for variability in clinical phenotype. We have used the method of repeat expansion detection to examine these predictions in a sample of 133 Caucasian DSM-III-R bipolar I probands from the British Isles. We found no evidence to support the notion that CAG/CTG TNR genes are major determinants of phenotypic severity or age at onset in the population examined, and conclude that for most cases of bipolar disorder TNR genes may operate as susceptibility genes rather than as single genes of major effect