152 research outputs found
Avian sex determination and aromatase gene
Sex is the most important exchange method of the genetic information in eukaryotes. Sex determination mechanism is varied depending on the species, however, sex differentiation mechanism in vertebrates are basically similar. Sex determination of birds is controlled by the sex chromosomes and their sexual differentiation
are critically controlled by estrogen. Because estrogen is biosynthesized by aromatase, it is possible to find the sex-determining gene of birds by analyzing the transcriptional regulatory mechanism. While there have been conducting research on the basis of this concept, the mechanism has not yet been fully elucidated. On the other hand, DMRT1 gene has been cloned as a strong candidate in the sex-determining gene of birds. Analysis of cascade leading to the aromatase gene from DMRT1 gene is an important issue in the future
Comparison of promoters for transient gene expression in avian cells
Genome editing technology by the CRISPR/Cas9, which was developed in 2012, is applicable in a variety of species. In birds, because the techniques of gene transfer and gene disruption has not been established, CRISPR/Cas9 method using adeno-associated virus (AAV) vector is the ideal combination as genome editing in vivo. However, in the use of AAV vectors, there is a problem to be solved that there is a limit on the size of the gene can be introduced. Therefore, it is important to minimize as much as possible the size of the gene. One strategy is to change the Cas9 gene into smaller ones, the other one is to minimize the promoter sequence. In this study, for the purpose of minimization of the promoter sequence to be introduced, the activities of the promoters to be general-purpose in mammals were verified in avian cells. CMV, CAG, and miCMV promoter shorten the CMV are all had sufficient activity in avian cells
Error Analysis of the Cholesky QR-Based Block Orthogonalization Process for the One-Sided Block Jacobi SVD Algorithm
The one-sided block Jacobi method (OSBJ) has attracted attention as a fast and accurate algorithm for the singular value decomposition (SVD). The computational kernel of OSBJ is orthogonalization of a column block pair, which amounts to computing the SVD of this block pair. Hari proposes three methods for this partial SVD, and we found through numerical experiments that the variant named "V2", which is based on the Cholesky QR method, is the fastest variant and achieves satisfactory accuracy. While it is a good news from a practical viewpoint, it seems strange considering the well-known instability of the Cholesky QR method. In this paper, we perform a detailed error analysis of the V2 variant and explain why and when it can be used to compute the partial SVD accurately. Thus, our results provide a theoretical support for using the V2 variant safely in the OSBJ method
Potential Changes and Microvibration Responses in the Eyelid Elicited by Single Flash Stimulation.
The potential changes and microvibration (MV) responses caused in the upper eyelid by single flash stimulation to both eyes or a single eye were obtained with the summation technique and their physiologic properties were investigated in healthy resting subjects with eyes closed. It seems likely that the lid potentials evoked photically mainly consist of electromyographic components due to the excitation of the orbicularis oculi through photopalpebral reflex and probably electroretinographic component, because of its disappearance in the occluded eyelid. .................. potential; microvibration response; eyelid; flas
Causal relationship between eWOM topics and profit of rural tourism at Japanese Roadside Stations "MICHINOEKI"
Affected by urbanization, centralization and the decrease of overall
population, Japan has been making efforts to revitalize the rural areas across
the country. One particular effort is to increase tourism to these rural areas
via regional branding, using local farm products as tourist attractions across
Japan. Particularly, a program subsidized by the government called Michinoeki,
which stands for 'roadside station', was created 20 years ago and it strives to
provide a safe and comfortable space for cultural interaction between road
travelers and the local community, as well as offering refreshment, and
relevant information to travelers. However, despite its importance in the
revitalization of the Japanese economy, studies with newer technologies and
methodologies are lacking. Using sales data from establishments in the Kyushu
area of Japan, we used Support Vector to classify content from Twitter into
relevant topics and studied their causal relationship to the sales for each
establishment using LiNGAM, a linear non-gaussian acyclic model built for
causal structure analysis, to perform an improved market analysis considering
more than just correlation. Under the hypotheses stated by the LiNGAM model, we
discovered a positive causal relationship between the number of tweets
mentioning those establishments, specially mentioning deserts, a need for
better access and traf^ic options, and a potentially untapped customer base in
motorcycle biker groups
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology
<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA<sup>Val </sup>promoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p
Characterization of Bovidae sex-determining gene SRY
In mammals, testis determination is under the control of the sex-determining gene SRY. This Y-linked gene encodes a protein with a DNA binding domain similar to those found in high-mobility-group proteins. Here we report the cloning and sequences of the SRY genes of yak and Chinese native cattle. Our data show that SRY genes in Bovidae are less divergent, especially in the coding and 3' regions
Comparison of Mortality between Japanese Peritoneal Dialysis and Hemodialysis Patients: A 5-Year Multicenter Follow-Up Study
To examine the relationship between dialysis modality and prognosis in Japanese patients, we conducted a prospective multicenter observational study. We recruited 83 background-matched peritoneal dialysis (PD) and 83 hemodialysis (HD) patients (average age, 64.9 years; men, 53.6%; diabetic patients, 22.9%; median duration of dialysis, 48 months in all patients) and followed them for 5 years. During the follow-up period, 27 PD patients (16 cardiovascular and 11 non-cardiovascular deaths) and 27 HD patients died (14 cardiovascular and 13 non-cardiovascular deaths). There were 8 PD patients switched to HD, and 6 PD patients received renal transplantation. Kaplan-Meier analysis revealed that the crude survival rate was not significantly different at the end of 5 years (PD 67.5% versus 67.5%, log-rank P = 0.719). The difference in cardiovascular and non-cardiovascular mortalities between PD and HD was not statistically significant. Multivariate Cox analysis showed that the independent predictors for death were age and serum albumin levels, but not the dialysis modality. This study showed that the overall mortality was not significantly different between PD and HD patients, which suggests that dialysis modality might not be an independent factor for survival in Japanese patients
Periostin Promotes Tumor Lymphangiogenesis
Background: Metastasis to regional lymph nodes via lymphatic vessels plays a key role in cancer progression. Tumor lymphangiogenesis is known to promote lymphatic metastasis, and vascular endothelial growth factor C (VEGF-C) is a critical activator of tumor lymphangiogenesis during the process of metastasis. We previously identified periostin as an invasion- and angiogenesis-promoting factor in head and neck squamous cell carcinoma (HNSCC). In this study, we discovered a novel role for periostin in tumor lymphangiogenesis.
Methods and Findings: Periostin overexpression upregulated VEGF-C mRNA expression in HNSCC cells. By using conditioned media from periostin-overexpressing HNSCC cells, we examined tube formation of lymphatic endothelial cells. Conditioned media from periostin-overexpressing cells promoted tube formation. To know the correlation between periostin and VEGF-C, we compared Periostin expression with VEGF-C expression in 54 HNSCC cases by immunohistochemistry. Periostin expression was correlated well with VEGF-C expression in HNSCC cases. Moreover, correlation between periostin and VEGF-C secretion was observed in serum from HNSCC patients. Interestingly, periostin itself promoted tube formation of lymphatic endothelial cells independently of VEGF-C. Periostin-promoted lymphangiogenesis was mediated by Src and Akt activity. Indeed possible correlation between periostin and lymphatic status in periostin-overexpressing xenograft tumors and HNSCC cases was observed.
Conclusions: Our findings suggest that periostin itself as well as periostin-induced upregulation of VEGF-C may promote lymphangiogenesis. We suggest that periostin may be a marker for prediction of malignant behaviors in HNSCC and a potential target for future therapeutic intervention to obstruct tumoral lymphatic invasion and lymphangiogenesis in HNSCC patients
- …