Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgenresponse elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNaseI-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at ;24.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cellspecific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line

A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans

Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene

A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

The DNA mismatch repair (MMR) system corrects DNA replication mismatches thereby contributing to the maintenance of genomic stability. MMR deficiency has been observed in prostate cancer but its impact on the genomic landscape of these tumours is not known. In order to identify MMR associated mutations in prostate cancer we have performed whole genome sequencing of the MMR deficient PC346C prostate cancer cell line. We detected a total of 1196 mutations in PC346C which was 1.5-fold higher compared to a MMR proficient prostate cancer sample (G089). Of all different mutation classes, frameshifts in mononucleotide repeat (MNR) sequences were significantly enriched in the PC346C sample. As a result, a selection of genes with frameshift mutations in MNR was further assessed regarding its mutational status in a comprehensive panel of prostate, ovarian, endometrial and colorectal cancer cell lines. We identified PRRT2 and DAB2IP to be frequently mutated in MMR deficient cell lines, colorectal and endometrial cancer patient samples. Further characterization of PRRT2 revealed an important role of this gene in cancer biology. Both normal prostate cell lines and a colorectal cancer cell line showed increased proliferation, migration and invasion when expressing the mutated form of PRRT2 (ΔPRRT2). The wild-type PRRT2 (PRRT2wt) had an inhibitory effect in proliferation, consistent with the low expression level of PRRT2 in cancer versus normal prostate samples

Overexpression of Full-Length ETV1 Transcripts in Clinical Prostate Cancer Due to Gene Translocation

ETV1 is overexpressed in a subset of clinical prostate cancers as a fusion transcript with many different partners. However, ETV1 can also be overexpressed as a full-length transcript. Full-length ETV1 protein functions differently from truncated ETV1 produced by fusion genes. In this study we describe the genetic background of full-length ETV1 overexpression and the biological properties of different full-length ETV1 isoforms in prostate cancer. Break-apart FISH showed in five out of six patient samples with overexpression of full-length ETV1 a genomic rearrangement of the gene, indicating frequent translocation. We were able to study the rearrangements in more detail in two tumors. In the first tumor 5′-RACE on cDNA showed linkage of the complete ETV1 transcript to the first exon of a prostate-specific two exon ncRNA gene that maps on chromosome 14 (EST14). This resulted in the expression of both full-length ETV1 transcripts and EST14-ETV1 fusion transcripts. In chromosome spreads of a xenograft derived from the second prostate cancer we observed a complex ETV1 translocation involving a chromosome 7 fragment that harbors ETV1 and fragments of chromosomes 4 and 10. Further studies revealed the overexpression of several different full-length transcripts, giving rise to four protein isoforms with different N-terminal regions. Even the shortest isoform synthesized by full-length ETV1 stimulated in vitro anchorage-independent growth of PNT2C2 prostate cells. This contrasts the lack of activity of even shorter N-truncated ETV1 produced by fusion transcripts. Our findings that in clinical prostate cancer overexpression of full-length ETV1 is due to genomic rearrangements involving different chromosomes and the identification of a shortened biologically active ETV1 isoform are highly relevant for understanding the mechanism of ETV1 function in prostate cancer

A 36-gene Signature Predicts Clinical Progression in a Subgroup of ERG-positive Prostate Cancers

Background: The molecular basis of the clinical heterogeneity of prostate cancer (PCa) is not well understood. Objective: The purpose of our study was to identify and characterize genes in a clinically relevant gene expression signature in a subgroup of primary PCa positive for transmembrane protease, serine 2 (TMPRSS2)-v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG). Design, setting, and participants: We studied gene expression profiles by unsupervised hierarchical clustering in 48 primary PCas from patients with a long clinical follow-up. Results were correlated with clinical outcome and validated in an independent patient cohort. Selected genes from a defined classifier were tested in vitro for biologic properties. Intervention: Initial treatment of primary tumors was radical prostatectomy. Outcome measurements and statistical analysis: Associations between clinical and histopathologic variables were evaluated by the Pearson chi(2) test, Mann-Whitney U test, or Kruskal-Wallis test, where appropriate. The log-rank test or Breslow method was used for statistical analysis of Kaplan-Meier survival curves. Results and limitations: Most tumors that overexpressed ERG clustered separately from other primary PCas. No differences in any clinical end points between ERG-positive and ERG-negative cancers were detected. Importantly, within the ERG-positive samples, two subgroups were identified, which differed significantly in prostate-specific antigen recurrence-free survival, and cancer-specific and overall survival. From our findings, we defined a gene expression classifier of 36 genes. In a second, com Conclusions: The classifier identified can contribute to prediction of tumor progression in ERG-positive primary prostate tumors and might be instrumental in therapy decisions. (C) 2013 European Association of Urology. Published by Elsevier B.V. All rights reserved