Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgenresponse elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNaseI-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at ;24.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cellspecific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line

A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans

Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene

A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

The DNA mismatch repair (MMR) system corrects DNA replication mismatches thereby contributing to the maintenance of genomic stability. MMR deficiency has been observed in prostate cancer but its impact on the genomic landscape of these tumours is not known. In order to identify MMR associated mutations in prostate cancer we have performed whole genome sequencing of the MMR deficient PC346C prostate cancer cell line. We detected a total of 1196 mutations in PC346C which was 1.5-fold higher compared to a MMR proficient prostate cancer sample (G089). Of all different mutation classes, frameshifts in mononucleotide repeat (MNR) sequences were significantly enriched in the PC346C sample. As a result, a selection of genes with frameshift mutations in MNR was further assessed regarding its mutational status in a comprehensive panel of prostate, ovarian, endometrial and colorectal cancer cell lines. We identified PRRT2 and DAB2IP to be frequently mutated in MMR deficient cell lines, colorectal and endometrial cancer patient samples. Further characterization of PRRT2 revealed an important role of this gene in cancer biology. Both normal prostate cell lines and a colorectal cancer cell line showed increased proliferation, migration and invasion when expressing the mutated form of PRRT2 (ΔPRRT2). The wild-type PRRT2 (PRRT2wt) had an inhibitory effect in proliferation, consistent with the low expression level of PRRT2 in cancer versus normal prostate samples

Identification of two transcription activation units in the N-terminal domain of the human androgen receptor

To locate in detail the regions in the human androgen receptor (AR) involved in transcription activation, a series of N-terminal deletions was introduced in the wild type AR and in a constitutively active AR. The different constructs were tested for their capacity to activate transcription. Almost the entire N-terminal domain (residues 1-485) was necessary for full wild type AR activity when cotransfected with the (GRE)2tkCAT reporter in HeLa cells. In contrast, a smaller part of the N-terminal domain (amino acids 360-528) was sufficient for the constitutively active AR to induce transcription of the same (GRE)2tkCAT reporter in HeLa cells. This demonstrates the capacity of the AR to use different regions in the N-terminal domain as transcrip

Identification of two transcription activation units in the N-terminal domain of the human androgen receptor

To locate in detail the regions in the human androgen receptor (AR) involved in transcription activation, a series of N-terminal deletions was introduced in the wild type AR and in a constitutively active AR. The different constructs were tested for their capacity to activate transcription. Almost the entire N-terminal domain (residues 1-485) was necessary for full wild type AR activity when cotransfected with the (GRE)2tkCAT reporter in HeLa cells. In contrast, a smaller part of the N-terminal domain (amino acids 360-528) was sufficient for the constitutively active AR to induce transcription of the same (GRE)2tkCAT reporter in HeLa cells. This demonstrates the capacity of the AR to use different regions in the N-terminal domain as transcription activation units (TAUs). To obtain additional information of AR N-terminal TAUs, the GAL4 DNA binding domain was linked to either the ent

Single nucleotide polymorphisms in CRTC1 and BARX1 are associated with esophageal adenocarcinoma

Objective: Recently, single nucleotide polymorphisms (SNPs) associated with esophageal adenocarcinoma (EAC) and Barrett's esophagus (BE) were identified; rs10419226 (CRTC10), rs11789015 (BARX1), rs2687201 (FOXP10), rs2178146 (FOXF1), rs3111601 (FOXF10), and rs9936833 (FOXF1). These findings indicate that genetic susceptibility could play a role in the initiation of EAC in BE patients. The aim of this study was to validate the association between these previously identified SNPs and the risk of EAC in an independent and large case-control study. Design: Six SNPs found to be associated with EAC and BE were genotyped by a multiplex SNaPshot analysis in 1071 EAC patients diagnosed and treated in the Netherlands. Allele frequencies were compared to a control group derived from the Rotterdam Study, a population-based prospective cohort study (n = 6206). Logistic regression analysis and meta-analysis were performed to calculate odds ratios (OR). Results: Rs10419226 (CRTC1) showed a significantly increased EAC risk for the minor allele (OR = 1.17, P = 0.001), and rs11789015 (BARX1) showed a significantly decreased risk for the minor allele (OR = 0.85, P = 0.004) in the logistic regression analysis. The meta-analysis of the original GWAS and the current study revealed an improved level of significance for rs10419226 (CRTC1) (OR = 1.18, P = 6.66 × 10-10 ) and rs11789015 (BARX1) (OR = 0.83, P = 1.13 × 10-8 ). Conclusions: This independent and large Dutch case-control study confirms the association of rs10419226 (CRTC1) and rs11789015 (BARX1) with the risk of EAC. These findings suggest a contribution of the patient genetic make-up to the development of EAC and might contribute to gain more insight in the etiology of this cancer