Visual Techniques for the Determination of Age and Sex of Sambar Deer (Rusa unicolor unicolor) in Horton Plains National Park, Sri Lanka

A standard table was developed to facilitate the unambiguous identification of growth stages and gender of sambar deer (Rusa unicolor unicolor) calves from newborn to one year in Horton plains national park, Sri Lanka (HPNP). This was developed by evaluating the phenotypic characteristics of sambar deer calves (n=97±34) of known growth stages in 2018. A standard table was prepared based on their sex, shape of the snout, shape of the head and forehead between ears, size of the ears for the face, size of the neck, shape of the body, shape of the belly, shape of the back, size of the body and the behavior. The accuracy of the table was tested by using experienced people (n=30) who are regular visitors at HPNP. The average number of sambar deer in HPNP grassland in year 2018, during the study period was 919. In new born calves the accuracy of identification of gender was 83% and the accuracy of identification of growth phase was 87%. Identification of both sex and the growth phase of newborn calves simultaneously was 77% accurate. When the calves reach two weeks from birth, the accuracy of identifying their sex was increased to 93% whereas their growth phase was identified with 90% accuracy. The accuracy of identifying both sex and the growth phase simultaneously was 83% in calves two weeks after birth. When the calves reached five months from calving, the accuracy of identification of both sex and the growth phase increased to 100%. Calves at six months age, the identification of growth phase was 97% accurate. Accuracy of identifying of both gender and the growth phase simultaneously was 97%. In the sample between six months and one year the accuracy of identification of gender and growth phase was 95%. Starting from newborn stage to six months of age, the accuracy of identification based on the characters of the standard table increased steadily. However, upon reaching six months, there was a declination of identifying both gender and the growth phase of the sambar deer in HPNP simultaneously.Keywords: Sambar deer calves, Gender, Growth phase, Horton Plain

Characterisation of Mitochondrial 12s rRNA Gene of Yellow Striped Chevrotain (Moschiola kathygre) and Development of a PCR-RFLP marker for the Unambiguous Identification of the Species

In the evolutionary studies of mammals, the study of Tragulids, commonly known as Chevrotains or mouse deer, is very important since they represent the basal branch of ruminants. They are the only members of the infraorder Tragulina and have not undergone significant changes since the Miocene period. Most of the Tragulids have become extinct leaving three genera to be found at present including, Tragulus, Hyemoschus, and Moschiola. The genus Moschiola consists of three species that can be found both in India (M. indica) and Sri Lanka (M. meminna and M. kathygre). The complete mitochondrial genome of Indian mouse deer has been sequenced recently but Sri Lankan mouse deer lacks molecular information. In the present study, the mitochondrial 12s rRNA gene sequence of Yellow striped Chevrotain (M. kathygre) was analysed with the objective of formulating a marker for the identification of the species. The genomic DNA from hair follicles was isolated and the 12s rRNA mitochondrial region was amplified using universal primers, forward primer 5’CAAACTGGGATTAGATACCCCACTAT 3’and reverse primer 5’GAGGGTGACGGGCGGTGTGT 3’. The sequence was compared with other deer species and the Indian Chevrotain. The Sri Lankan yellow striped chevrotain shared the highest sequence similarity of 91.19% with the Indian Chevrotain and above 89% similarity with other deer species. In silico analysis of 12s rRNA gene sequence revealed that a PCR-RFLP approach can be used to differentiate Yellow striped Chevrotain from the Indian Chevrotain using RsaI, BsrI, DraI and HinfI restriction enzymes.Keywords: Yellow striped chevrotain, Tragulids, 12s rRNA gene, PCR-RFL

Formulation and Evaluation of a Laterite Soil Based Scrubbing Effect Herbal Cleansing Bar

Cosmetics play a dynamic role for every person to have a glad and confident life. In the current scenario, herbal cosmeceuticals have more demand because they have no side effects. People often suffer from acne, whiteheads, and blackheads, so scrubbing becomes essential. The main objective of the present study was to prepare a herbal-mineral facial scrubbing effect cleansing bar. Majorly facial skin comes in direct contact with dirt, pollution, dust particles, and many dead cells. Some facial preparations are required to remove the dead cells and make the skin in fine fettle, cleaned, and nourished. The present study formulated a laterite soil-based herbal scrubbing effect cleansing bar for all typed skin using laterite soil powder. In contrast, glycerin soap base, virgin coconut oil, olive oil, bee honey, aloe vera, lime juice, turmeric, and lavender essential oil are used and evaluated by using various parameters such as physical appearance, color, odor, pH, washability, irritants, stability studies, microbial tests, heavy metals, and total fatty matter. It was given fruitful results with all the tests. The herbal formulation had characteristic pleasant order, reddish-brown in color having, light, non-irritant to the skin and quite an elegant, microbial and heavy metal safe product. Thus, the formulated scrubbing effect facial cleansing bar can be utilized efficaciously without a side effect that exfoliates makes healthy, clean, and glowing skin. Keywords: Facial scrub, Cosmetic, Herbal, Mineral, Laterite soi