Hydrodynamic acoustic plasmon resonances in semiconductor nanowires and their dimers

The hydrodynamic Drude model known from metal plasmonics also applies to semiconductor structures of sizes in between single-particle quantum confinement and bulk. But contrary to metals, for semiconductors two or more types of plasma may have to be taken into account in order to properly describe their plasmonic properties. In this combined analytical and computational study, we explore predictions of the recently proposed two-fluid hydrodynamic Drude model for the optical properties of plasmonic semiconductor nanowires, in particular for thermally excited InSb nanowires. We focus on the low-frequency acoustic surface and bulk plasmon resonances that are unique fingerprints for this model and are yet to be observed. We identify these resonances in spectra for single nanowires based on analytical calculations, and they are in complete agreement with our numerical implementation of the model. For dimers of nanowires we predict substantial increase of the extinction cross section and field enhancement of the acoustic localized surface plasmon resonance, which makes its observation in dimers more likely.Comment: I would like to inform that Dr.Abbas Zarifi is the corresponding author of this pape

Enhancement of magneto-optical responses in adjustable one-dimensional magnetophotonic crystals

We investigated the one-dimensional magnetophotonic crystals (1D − MPCs) created by magnetic defect layer sandwiched between dielectric photonic crystals (PCs) utilizing the 4×4 transfer matrix method (TMM). To simultaneously achieve high transmittance and large magneto-optical (MO) Faraday effect, we changed the repetition numbers of PCs and the thickness of defect layers. Using finite element method (FEM), we simulated the distribution of electric field in the length of structures. The efficient localization of light in the vicinity of defect layer led to MO responses enhancement and resonant transmittance inside the photonic band gap (PBG). For single cavity structure, the MO responses were enhanced for symmetric spatial configuration. By increasing the number of defect layer, the MO responses of MPCs were improved. The transmittance and Faraday rotation (FR) for MO multilayer structures having six cavities were obtained T = 0.92 and θF = 44.5° respectively. This is a proper case to design MO isolator applied in optical telecommunications

Enhancement of the Magneto-Optical Kerr Effect in One- Dimensional Magnetophotonic Crystals with Adjustable Spatial Configuration

We studied magnetophotonic crystals (MPCs) with introduced magneticdefect layer sandwiched between magnetic and dielectric Bragg mirrors. Thesemagnetophotonic crystals have excellent capabilities to enhance reflection and Kerrrotation simultaneously. By adjusting spatial configuration such as repetition numbersof Bragg mirrors and thickness of magnetic defect layer, we achieved the Kerr rotationangles more than 75˚ and reflection very close to 1. We briefly described theformulation of finite element method (FEM) and transfer matrix method (TMM). Theelectric field distribution and magnitude of it along the MPCs are simulated using FEM.Using the TMM, we calculated the MO responses of MPCs. With light localizationinside the magnetic defect layer and multiple reflections in it, the magneto-optical (MO)responses of these MPCs were significantly increased. The studied structures in thisresearch have high MO responses that make it suitable for designing MO elements inhighly sensitive devices and optical telecommunication tools

Finite difference time domain simulation of arbitrary shapes quantum dots

Utilizing the finite difference time domain (FDTD) method, energy eigenvalues of spherical, cylindrical, pyramidal and cone-like quantum dots are calculated. To do this, by the imaginary time transformation, we transform the schrödinger equation into a diffusion equation. Then, the FDTD algorithm is hired to solve this equation. We calculate four lowest energy eigenvalues of these QDs and then compared the simulation results with analytical ones. Our results clearly show that simulation results are in very good agreement with analytical results. Therefore, we can use the FDTD method to find accurate results for the Schrödinger equation

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection

Molecular Epidemiology and Phylogeny of Crimean-Congo Haemorrhagic Fever (CCHF) Virus of Ixodid Ticks in Khorasan Razavi Province of Iran

Background: Crimean–Congo hemorrhagic fever (CCHF) is a fatal disease caused by Nairovirus classified within the Bunyaviridae family. The virus is transmitted to humans through the bites of infected ticks or direct contact with viremic animals or humans. The current study aimed to detect the virus genome in ticks from Khorasan Razavi Province. Methods: One hundred hard ticks were collected randomly from 100 sheep in four different areas of the province. Collected ticks were kept alive and identified. All the ticks were analyzed for the presence of CCHF virus genome using reverse transcriptase polymerase chain reactions (RT-PCR). Results: The identified ticks were belonging to Hyalomma marginatum (16% female and 6% male), Rhipicephalus turanicus (52% female and 25% male), and Dermacentor raskemensis (1%). The CCHF virus genome was found in Hyalomma marginatum (5% male from Taibad and Sabzevar region and 1% female from Taibad). Genetic analysis of the virus genome isolated from two regions (Sabzevar and Taibad) showed 100% identity. Conclusion: This study indicated that CCHF should be regarded as a risk-borne infection in this province. Therefore, special health management is needed to control this disease

Assessment of Recombination in the S-segment Genome of Crimean-Congo Hemorrhagic Fever Virus in Iran

Background: Crimean-Congo Hemorrhagic Fever Virus (CCHFV) belongs to genus Nairovirus and family Bunyaviridae. The main aim of this study was to investigate the extent of recombination in S-segment genome of CCHFV in Iran. Methods: Samples were isolated from Iranian patients and those available in GenBank, and analyzed by phyloge­netic and bootscan methods. Results: Through comparison of the phylogenetic trees based on full length sequences and partial fragments in the S-segment genome of CCHFV, genetic switch was evident, due to recombination event. Moreover, evidence of multi­ple recombination events was detected in query isolates when bootscan analysis was used by SimPlot software. Conclusion: Switch of different genomic regions between different strains by recombination could contribute to CCHFV diversification and evolution. The occurrence of recombination in CCHFV has a critical impact on epidemi­ological investigations and vaccine design

Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens

The emergence of the SARS-CoV-2 virus, an unknown strain of coronavirus, has resulted in severe acute respiratory syndrome with high mortality rates worldwide. Due to the possibility of asymptomatic carriers, late diagnosis of infected individuals can lead to uncontrollable transmission of the disease, making early and accurate detection crucial in controlling the spread of the virus. In this study we identified high-binding-affinity aptamers targeting various strains of the SARS-CoV2 (COVID-19) virus, using the GO-Cell-SELEX (Graphene Oxide- Systematic Evolution of Ligands by Exponential Enrichment) strategy. A total of 96 aptamers were developed through 11 rounds of GO-Cell-SELEX from a random 40 nucleotide single-strand DNA (ssDNA) aptamer library. Using the surface plasmon resonance (SPR) method, the dissociation constant (Kd) values of all aptamers were calculated and two aptamers 52 and 91 with Kd 50 and 61 were selected for enzyme-linked apta-sorbent assay (ELASA). Aptamer 91 could detect various strains of the virus in above 97% of clinical samples obtained from nasopharyngeal swaps (NPS) specimens kept in viral transport media (VTM), confirmed by real-time PCR assay at COVID-19 Reference Diagnostic Laboratory of Iran, Pasture Institute. Aptamer 52 could detect the SARS-CoV2 virus in a competitive lateral flow assay (LFA) to be considered for a future designed kit. These two simple, specific, and sensitive tests can be used in combination for rapid and early diagnosis of various strains of the COVID-19 virus. Our results suggest that these two discovered aptamers present an opportunity for developing a new rapid aptamer-based coronavirus diagnostic kit

Surveillance of Rift Valley Fever in Iran between 2001 and 2011

Rift Valley fever virus (RVFV) is an acute zoonotic viral disease that mostly affects ruminants with an occasional spillover as human infection. Following the outbreak of RVF in Saudi Arabia in 2000, surveillance of both animal and human population in Iran increased until 2011. During this period 1206 ovine, 405 caprine, 325 bovine and 28 camel samples were tested for RVFV in nine provinces in Iran. None of these samples tested IgG positive. Moreover, amongst 37 clinically suspected human cases of patients with RVF symptoms, none of these samples tested positive for RVFV. Despite the fact that no positive cases in human or animal populations were identified in Iran, surveillance and monitoring of viral haemorrhagic fevers including RVFV will continue

Crimean-Congo Hemorrhagic Fever in the One-Humped Camel (Camelus dromedarius) in East and Northeast of Iran

Background: This comprehensive study was conducted on multi-purpose one-humped camel (Camelus dromedarius) sera and ticks to assess the epidemiological aspects of the Crimean-Congo hemorrhagic fever virus (CCHFV) in northeast Iran. Methods: From May 2012 to January 2013, eleven cities were randomly selected in the Khorasan Provinces of Iran as “clusters,” and at least 14 one-humped camels were sampled from each area. Reverse transcriptase polymerase chain reaction was used for the detection of the CCHFV genome in ticks. Sera were analyzed using specific enzyme-linked immunosorbent assay tests. Results: Four hundred and eighty ixodid ticks were collected, and the genome of the CCHFV was detected in 49 (10.2%) out of 480 ticks. The CCHFV genome was detected in two out of four tick species, and in tick samples from three cities in Khorassan-e-Jonoobi. All three provinces, and six out of eleven cities, were CCHFV-specific IgG-positive. In total, nine (5.3%) out of 170 one-humped camels were IgG-positive. The highest rate of IgG-positive samples was found in Nehbandan (16.67%). Conclusion: Continued surveillance and strictly enforced importation and quarantine practices should be imple­mented to prevent human exposure and the on-going dispersal of infected ticks and livestock in these regions. It is recommended that acaricides be used to prevent CCHF transmission to humans, and to reduce the tick population. In addition, care should be taken by abattoirs workers and people who work with one-humped camels