Mouse cytotoxic T cell-derived granzyme B activates the mitochondrial cell death pathway in a bim-dependent fashion

Cytotoxic T cells (Tc) use perforin and granzyme B (gzmB) to kill virus-infected cells and cancer cells. Recent evidence suggests that human gzmB primarily induces apoptosis via the intrinsic mitochondrial pathway by either cleaving Bid or activating Bim leading to the activation of Bak/Bax and subsequent generation of active caspase-3. In contrast, mouse gzmB is thought to predominantly induce apoptosis by directly processing pro-caspase-3. However, in certain mouse cell types gzmB-mediated apoptosis mainly occurs via the mitochondrial pathway. To investigate whether Bim is involved under the latter conditions, we have now employed ex vivo virus-immune mouse Tc that selectively kill by using perforin and gzmB (gzmB+Tc) as effector cells and wild type as well as Bim- or Bak/Bax-deficient spontaneously (3T9) or virus-(SV40) transformed mouse embryonic fibroblast cells as targets. We show that gzmB+Tc-mediated apoptosis (phosphatidylserine translocation, mitochondrial depolarization, cytochrome c release, and caspase-3 activation) was severely reduced in 3T9 cells lacking either Bim or both Bak and Bax. This outcome was related to the ability of Tc cells to induce the degradation of Mcl-1 and Bcl-XL, the anti-apoptotic counterparts of Bim. In contrast, gzmB+Tc-mediated apoptosis was not affected in SV40-transformed mouse embryonic fibroblast cells lacking Bak/Bax. The data provide evidence that Bim participates in mouse gzmB+Tc-mediated apoptosis of certain targets by activating the mitochondrial pathway and suggest that the mode of cell death depends on the target cell. Our results suggest that the various molecular events leading to transformation and/or immortalization of cells have an impact on their relative resistance to the multiple gzmB+Tc-induced death pathways

First Salmonella spp. prevalence study in pigs and pork products from the province of Córdoba, Argentine

The study of the prevalence of Salmonella spp. in the pig and pork production chain is important to reduce the risk of spreading this pathogen into the human population. The aim of this study was to estimate the prevalence of Salmonella spp. in pigs and pork products from Córdoba. Mesenteric lymph nodes samples from 580 finishing pigs from different pig farms , and 420 samples (83 batches) of fresh pork products (the so-called “chorizo fresco de cerdo”) from different retailers were analyzed. ISO 6579:2002 standard protocol was used for Salmonella isolation. Prevalence of Salmonella spp. in finishing pigs in Córdoba was 41.5% (95%CI 37.6%- 45.6%). According to pig´s origin the province was split in North, Central and South region. The prevalence observed in each region was 49.5%, 43.0% and 36.0% respectively. The significantly higher prevalence observed in the North may be associated with the precarious conditions of the pig production sector in that area, compared to the better pig producing practices in the southern region. Prevalence of Salmonella spp. in fresh pork products was 17.4% (95%CI 15.8%-23.4%). Based on the Argentine Food Codex criteria, 34/83 (40.9%) of the analyzed batches should be rejected given the presence Salmonella spp. positive. In addition, total coliforms were also analyzed on these pork samples following national legislation and 42 (63.0%) of the batches should have been rejected according to coliform total count. Overall, only 13% of the batches fulfilled both criteria for acceptance. In conclusion, the high prevalence of Salmonella spp. in pig farms and of Salmonella spp. and coliforms in these type of pork products suggested important safety breakdowns along the pig production and pork elaboration processes. An important effort should be done to reach suitable hygienic and sanitary standards for pig and pork production in the province of Córdoba

Toll-like receptors 2 and 4 cooperate in the control of the emerging pathogen Brucella microti

Toll-like receptors (TLRs) recognize pathogen-derived molecules and play a critical role during the host innate and adaptive immune response. Brucella spp. are intracellular gram-negative bacteria including several virulent species, which cause a chronic zoonotic infection in a wide range of mammalian hosts known as brucellosis. A new Brucella species, Brucella microti, was recently isolated from wild rodents and found to be highly pathogenic in mice. Using this species-specific model, it was previously found that CD8+ T cells are required to control this infection. In order to find out the role of TLR-mediated responses in the control of this pathogen, the course of infection of B. microti was analyzed over 3 weeks in wild-type (WT) and TLR knock out (KO) mice including TLR2-/-, TLR4-/-, TLR9-/-, TLR2×4-/- and TLR2×4×9-/-. WT and single TLR2, TLR4 and TLR9 KO mice similarly control infection in liver and spleen. In contrast, bacterial clearance was delayed in TLR2×4-/- and TLR2×4×9-/- mice at 7 and 14 days post-infection. This defect correlated with impaired maturation and pro-inflammatory cytokine production in B. microti-infected dendritic cells from TLR2×4-/- and TLR2×4×9-/- mice. Finally, it was found that Tc cells from TLR2×4-/- and TLR2×4×9-/- mice showed reduced ability to inhibit growth of B. microti in macrophages, suggesting the involvement of TLR2 and 4 in the generation of specific Tc cells. Our findings indicate that TLR2 and TLR4 are required to control B. microti infection in mice and that this effect could be related to its participation in the maturation of dendritic cells and the generation of specific CD8+ Tc cells

The 2011 October Draconids outburst. I. Orbital elements, meteoroid fluxes and 21P/Giacobini-Zinner delivered mass to Earth

On October 8th, 2011 the Earth crossed the dust trails left by comet 21P/Giacobini-Zinner during its XIX and XX century perihelion approaches with the comet being close to perihelion. The geometric circumstances of that encounter were thus favorable to produce a meteor storm, but the trails were much older than in the 1933 and 1946 historical encounters. As a consequence the 2011 October Draconid display exhibited several activity peaks with Zenithal Hourly Rates of about 400 meteors per hour. In fact, if the display had been not forecasted, it could have passed almost unnoticed as was strongly attenuated for visual observers due to the Moon. This suggests that most meteor storms of a similar nature could have passed historically unnoticed under unfavorable weather and Moon observing conditions. The possibility of obtaining information on the physical properties of cometary meteoroids penetrating the atmosphere under low-geocentric velocity encounter circumstances motivated us to set up a special observing campaign. Added to the Spanish Fireball Network wide-field all-sky and CCD video monitoring, other high-sensitivity 1/2" black and white CCD video cameras were attached to modified medium-field lenses for obtaining high resolution orbital information. The trajectory, radiant, and orbital data of 16 October Draconid meteors observed at multiple stations are presented. The results show that the meteors appeared from a geocentric radiant located at R.A.=263.0+-0.4 deg. and Dec.=+55.3+-0.3 deg. that is in close agreement with the radiant predicted for the 1873-1894 and the 1900 dust trails. The estimated mass of material from 21P/Giacobini-Zinner delivered to Earth during the six-hours outburst was around 950+-150 kg.Comment: Manuscript in press in Monthly Notices of the Royal Astronomical Society, submitted to MNRAS on November 16th, 2012 Accepted for publication in MNRAS on April 28th, 2013 Manuscript Pages: 21 Tables: 8 Figures: 4 Manuscript associated: "The 2011 October Draconids outburst. II. Meteoroid chemical abundances from fireball spectroscopy" by J.M. Madiedo is also in press in the same journa

Evaluation of seminal characteristics of Pelibuey and East Friesian rams at two different times of the year

Objective: To determine the changes in seminal quality of Pelibuey and East Friesian rams during the non-breeding (long days; March-June) and breeding seasons (short days; September-December) at 19° north latitude. Design/methodology/approach: To determine changes in seminal quality over time, seminal parameters of rams, collected with an artificial vagina were evaluated over 32 weeks. An analysis of variance was performed with a completely randomized design in a 2 x 2 factorial arrangement (breed and season). Results: No differences were found within breeds or between breeds in the same season in the evaluated seminal parameters; however, differences were reported between seasons in the live weight parameters, lower in the non-reproductive season, in addition to an increased scrotal circumference and mass motility during the reproductive season. Study limitations/implications: Semen parameters estimation, in field trials, is subjective compared to computerized semen evaluation systems, it is therefore desirable to have extensive experience in semen evaluation at the field level before starting the study. To confirm the results obtained in this study, a new experiment with a larger number of experimental units is suggested. Findings/conclusions: It is concluded that in the environmental and management conditions, where the seminal evaluation took place, no differences were found between breeds, suggesting that the Pelibuey and East Friesian breeds at 19° north latitude do not decrease their seminal parameters during the non-breeding season compared to the breeding season. This suggest that these two sheep breeds are able to reproduce, in such conditions, all year round

El mayordomo, un olvidado de la ganadería?

Se presenta una síntesis de un estudio sobre la caracterización y participación administrativa de los mayordomos en las fincas lecheras de la meseta central de la sabana de Bogotá. La muestra estuvo conformada por predios entre 10 y 100 hectáreas de los municipios de Subachoque, Madrid, Tenjo, Mosquera y Funza. El trabajo se orientó al análisis de tres temas básicos: socioculturales, referidos a la identificación de los intereses y las condiciones sociales del mayordomo, organización laboral, dirigido a ubicar el papel y la importancia del mayordomo dentro de la estructura organizacional de la fina, y el de transferencia de tecnología, enfocado a determinar las fuentes de información tecnológica y la preferencia sobre éstas por parte del mayordomo. Los resultados mostraron que solamente el 9 por ciento de los mayordomos recibieron información técnica interpersonal de los asistentes técnicos particulares. Igualmente, los propietarios, tampoco resultaron fuente importante en la difusión tecnológica (9 por ciento). La capacitación a través de cursos formales que el productor ofrece al mayordomo es mínima (50 por ciento) y ha sido sobre inseminación artificial (91 por ciento)

Detailed spectroscopy of doubly magic Sn-132

The structure of the doubly magic Sn-132(50)82 has been investigated at the ISOLDE facility at CERN, populated both by the beta(-) decay of In-132 and beta(-)-delayed neutron emission of In-133. The level scheme of Sn-13(2) is greatly expanded with the addition of 68 gamma transitions and 17 levels observed for the first time in the beta decay. The information on the excited structure is completed by new gamma transitions and states populated in the beta-n decay of In-133. Improved delayed neutron emission probabilities are obtained both for In-132 and In-133. Level lifetimes are measured via the advanced time-delayed beta gamma gamma(t) fast-timing method. An interpretation of the level structure is given based on the experimental findings and the particle-hole configurations arising from core excitations both from the N = 82 and Z = 50 shells, leading to positive- and negative-parity particle-hole multiplets. The experimental information provides new data to challenge the theoretical description of Sn-132

Europium and Terbium doped apatite obtained by hydrothermal transformation of biogenic calcium carbonate from oyster shells

Póster presentado en The International Conference on Crystal Growth and Epitaxy-ICCGE-20, Naples (Italy), 30-july 4 august 2023Seashell wastes from aquaculture and canning industries represent an important environmental issue nowadays [1]. Shells are made of calcium carbonate (CaCO3) with a low content of proteins and polysaccharides (1-5 wt.%). The valorization of this waste by using it as a raw material for the production of calcium phosphates may have a positive impact both environmental and economic, thus contributing to the sustainability of this important sector. In some biomedical industries, there is a growing demand for calcium phosphate (apatite) crystals including nanosized, micron-sized, and larger sizes. This work is devoted to producing functional apatite nanocrystals, eg. doped with luminescent lanthanide (Ln3+) ions [2,3], using oyster shells (Mg-calcite, 5 wt.% Mg) from the species Crassostrea gigas as a Ca source. Experiments were performed by a one-pot hydrothermal method using KH2PO4 as a P reagent, a P/CaCO3 ratio of 0.6 (stoichiometric respect to hydroxyapatite), and either Eu3+ or Tb3+ (10and 20 mM). Characterization by XRD, FTIR, Raman, and ICP revealed the full transformation of biogenic CaCO3 particles into doped apatite. It was obtained at 160 ºC with (Ca+Ln)/P ratios 1.72 and 1.68 when adding Eu3+ and Tb3+ (10 mM) and 1.88 and 1.99 when the lanthanide concentration in the solution increased to 20 mM. In both cases, nanocrystals displayed needleor plate-like morphologies and polydisperse size distribution. Luminescence characterization of the nanoparticles showed different luminescence spectra depending on the doping ion. They displayed excitation and emission wavelengths of 395nm and 616 nm for the Eu3+-, and 372 and 543 nm for the Tb3+-doped samples. The relative luminescence intensities correlated well with their Ln3+ content while luminescence lifetimes (up to 1600 ¿s) were higher for Tb3+-doped apatites. Overall, the nanoparticles showed notable luminescent behavior and could find application as luminescent probes for bioimaging or nanophosphors for the electronic industry. Acknowledgements: Grant ref. PCI2020-112108 is funded by MCIN/AEI/10.13039/501100011033 (Spain) and the European Union "NextGenerationEU"/PRTR". PCI2020-112108 is part of the project CASEAWA of ERA-NET Cofund BlueBio H2020.Grant ref. PCI2020-112108 is funded by MCIN/AEI/10.13039/501100011033 (Spain) and the European Union "NextGenerationEU"/PRTR". PCI2020-112108 is part of the project CASEAWA of ERA-NET Cofund BlueBio H202

Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities

Background and Objective: In the present study, a wild fungus, Hypocrea pachybasioides, has molecularly identified using ribosomal ITS5-ITS4 region as well as analysis of chemically functional groups. This fungus grows on rotten woods. This study is the first report on chemical and pharmacological activities of the fungus. The Hypocrea genus has been linked to another fungus such as Trichoderma spp., which makes it important to identify this species. There are no studies on the fungus chemical and pharmacological characteristics. The aim of the study was to identify a wild fungus through molecular methods, as well as its chemical and pharmacological identification. Material and Methods: Compounds from methanolic extract of the mycelium and those secreted in the culture broth were assessed. First, fungal deoxyribonucleic acid was extracted for molecular identification. Qualitative assessments were carried out for compounds such as tannins, saponins and coumarins, as well as quantitative assessments for total phenols and flavonoids. High-pressure liquid chromatography analysis was carried out for organic acids. Furthermore, antiproliferative assessments were carried out using sulforhodamine B method. Results and Conclusion: Assessments carried out on both fractions showed that compounds such as alkaloids and saponins included the highest quantities in the suggested hedonic scale. In contrast, anthraquinones were detected in lower quantities, while coumarins and tannins were not detected. Methanolic extract from mycelia showed cytotoxic activity in HeLa cell line. Therefore, Hypocrea pachybasioides can be addressed as a candidate for further pharmacological studies based on the criteria from the National Institutes of Health of the United States. This is suggested as a potentially biotechnological model for identifying various metabolites with therapeutic characteristics. Conflict of interest: The authors declare no conflict of interest.   Introduction   Hypocrea is a genus of fungi belonging to the class of Ascomycetes. Its species are saprophytes and predators of other fungi. There are 509 species belonging to Hypocrea genus, most of them identified by their morphological characteristics. These fungi are widely distributed and grow in tropical, subtropical, moist, arid, temperate and boreal forests. They are brightly or slightly colored and can develop on rotten woods in the form of a shelf. These fungi have been associated with other species of Ascomycota and Basidiomycota of the anamorphic type [1]. Furthermore, Hypocrea (H.) is linked to the anamorphic fungi of Trichoderma spp. since all species have been reported as phylogenetically relatives [1, 2]. All these characteristics make difficulties to identify several species belonging to Hypocrea [2]. Thus, molecular methods are useful tools for the identification of these fungi with phenotypic and genotypic complexities within the species of Hypocrea/ Trichoderma. Molecular identification is important since several species of Hypocrea (anamorph to Trichoderma) have shown activities against pathogenic fungal species such as Phytium spp., Rhizoctonia solani and Verticillium dahliae. Moreover, they can act on Botrytis cinerea, which causes the root rot of forest species, suggesting protective roles to avoid decay in fruit storage [3]. Biological control by Hypocrea spp. was verified in the treatment of pathogenic species such as Fusarium spp. of tomato crops [4]. Similarly, it has been demonstrated that the fungi synthesize chemical compounds that accelerate growth of various vegetable crops. Lo and Lin (2002) [5] reported positive effects on soil using Trichoderma (T.) harzianum for the cultivation of squash and cucumbers while Keswani et al. (2014) reported that Trichoderma spp. secreted several compounds that acted as growth regulators for horseradish, tomato, rice and tobacco [6]. In contrast, studies on compounds secreted by Hypocrea spp. have not been carried out. Since other genera such as Trichoderma are anamorph, it has been suggested that Hypocrea spp. possibly produce various compounds with simple or complex molecular structures and various chemical-biological characteristics. Secondary metabolites such as lignans, flavonoids, phenols, terpenes, sterols, alkaloids, coumarins and antibiotics with various biological characteristics can provide novel uses in various sectors of food, agrochemical and pharmaceutical industries [7]. In the present study, a wild fungus was isolated and identified as H. pachybasioides by molecular approaches. Contents of chemically functional groups such as alkaloids, saponins, anthraquinones, coumarins and tannins were analyzed as well. Moreover, total phenols and flavonoids were assessed in extracts from mycelia and those secreted into the culture broth. The cytotoxic effects of these metabolites were also investigated in three different human tumor cell lines. These data may be useful for further isolations of H. pachybasioides metabolites as potential biotechnological compounds. Materials and Methods 2.1. Fungus collection Fungi used in this study were collected from the Sierra de Tequexquinahuac, Texcoco, Estado de Mexico. Taxo-nomic identification was carried out in the Fungi Laboratory of the Universidad Autonoma Chapingo. 2.2. Culture conditions Collected fungi were disinfected in 1% sodium hypochlorite (v/v) solution for 10 min and then transferred into sterile distilled water (DW) (30 ml) to remove excess sodium hypochlorite. A slice of the fungi was transferred into a Petri dish with potato dextrose agar (PDA) media and incubated at 25 °C for a week (w). After growing the fungi on the plate, a mycelial disk was inoculated into 100 ml of potato dextrose broth (PDB) media and incubated at 25 °C for a week (w). Mycelia were separated from the culture media via filtration and incubated at 35 °C for 3 d. Dehydrated mycelia were pulverized using mortar and then 20 mg of the sample were used for the isolation of DNA. 2.3. DNA extraction Briefly, DNA extraction was carried out using AxyPrep multisource genomic DNA miniprep kit (cat. AP-MN-MS-GDNA-50, Axygen, Union City, CA, USA), based on the manufacturer’s instructions. The DNA integrity was visualized on 0.7% (w/v) agarose gels stained with GelRed (Nucleic Acid Gel, Biotium; Hayward, CA, USA) using MultiDoc-It (UVP; Upland, CA, USA). 2.4. Amplification of the ITS region using PCR The PCR reactions were prepared using the primer pair of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAA) [9]. The reaction contained 40 ng of genomic DNA, Vent enzyme buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (each 0.2 μM) and 1.25 U of Vent polymerase enzyme (BioLabs, New England Biolad, Ipswich, MA, USA) in a final volume of 50 µl. Amplification of the genes was carried out using Axigen thermal cycler (Axygen MaxyGene II Thermal Cycler, CA, USA) under the following conditions of one cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s; 5 °C for 45 s and 72°C for 1 min and then one cycle at 72 °C for 5 min. Amplicons were electrophoresed on 2% (w/v) agarose gels. 2.5. Molecular identification of Hypocrea pachybasioides The amplified PCR products of the ITS region were cloned into the vector of pJET1.2/blunt (Thermo Scientific, USA) to achieve a complete sequence of the analyzed and unknown regions. Vectors with the inserts were transformed into competent Escherichia coli Top 10F´ cells (Invitro-genTM, Waltham, MA, USA). Plasmid DNA was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific, Waltham, MA, USA) based on the manufac-turer's instructions. Positive clones were verified through digestion with BglII to release a 550-bp fragment. In addition, clones were sequenced using primers of pJET forward (CGACTCACTATAGGGAGAGCGGC) and pJET Reverse (AAGAACATCGATTTTCCATGGCAG), which was carried out at the Instituto de Biotecnología of the Universidad Autonoma Nacional de Mexico. The sequence was analyzed through sequence comparisons of the GenBank database (NCBI) using Blast algorithm [10].     2.6. Extracellular and intracellular fungal extracts To assess presence of chemically functional compounds e.g. alkaloids, anthraquinones, tannins, volatile coumarins and saponins. Methanol was used to achieve two extracts from the collected fungi, one from the concentrated culture broth (extracellular) and the other one from the mycelia (intracellular). Total phenolics and flavonoids were quanti-fied in the two samples. Moreover, methanol was used to isolate the metabolites. Erlenmeyer flasks with 100 ml of PDB media were inoculated with fungal mycelia and incubated at 25 °C for 10 d. Then, mycelia were separated from the culture media by filtration. Mycelia and filtered broth were dried in an oven at 35 °C for 3 d. Dried mycelia were pulverized using mortar and trans-ferred into 50 ml of methanol for 1 w. Methanolic extract was concentrated under decreased pressure using rotary evaporator. 2.7. Detection of alkaloids and anthraquinones Thin layer chromatography (TLC) was carried out using silica gel plaques with dimensions of 3 × 5 cm (60F254) and results revealed presence of alkaloids and anthraquinones using Dragendorff reagent and UV light, respectively. An aliquot (0.5 μl) of the extract was transferred onto a plate and set in a solvent system of dichloromethane-methanol (95:5). Alkaloids were verified by the appearance of brown-red spots using Dragendorff reagent. Anthraquinones were investigated with the typical yellow or red fluorescent coloring after exposing the plates to UV light [11]. 2.8. Detection of tannins and saponins To analyze tannins in the extracts, three various solutions (10 mL) were prepared, including % (w/v) Tube 1, 1% gelatin solution; Tube 2, 1% gelatin solution and 10% NaCl; and Tube 3, 10% NaCl. Then, 2 ml of the extract were transferred into each tube and vigorously mixed using vortex. White precipitate in Tubes 1 and 2 indicated presence of tannins [11]. To assess saponins in the fungal extract, 2 ml of the samples were transferred into 10 ml of water. Tubes were heated 30 min at 80 °C and then set to cool down at room temperature (RT) and then stirred vigorously. Presence of stable foams within 15–20 min indicated presence of saponins [11]. 2.9. Quantification of total phenols To assess total phenols in the extracts, Folin-Ciocalteu reagent was used based on a protocol by [12]. Results were expressed as mg gallic acid/g dry extract (mgGAE/g) [12]. 2.10. Quantification of total flavonoids The flavonoid content was assessed using standard quercetin following the protocol [12]. Results were reported in mg quercetin/g dry extract (mgQE/g) [12].     2.11. Analysis of organic acids Briefly, D,L-malic, oxalic and tartaric organic acids were detected in the fungal extracts using a methodology developed by [13]. Technically, 20 μl of three various samples were analyzed, including mycelia, filtered broth or the organic acid standards, which were injected into HPLC  of Agilent Technology model 1260 equipped with a quaternary pump (Agilent Technology, California, USA) with a multiple wavelength detector (MWD). The column included an X-Terra MS C18 column, 5 μm (4.6 × 250 mm) and the mobile phase consisted of phosphate buffer (50 mM, pH 2.8) in isocratic mode. The flow was adjusted to 0.7 ml/ min. Results were recorded at 210 nm and used in a standard curve. Results were expressed as parts per million. 2.12. Antiproliferative activity assay To assess cytotoxic effects of H. pachybasioides extracts in human epithelial carcinoma (HeLa). Cell line was incubated at 37 °C in a humidified atmosphere of 5% CO2 and 100% air in complete RPMI 1640 media. Cells in the log growth phase were treated with three various concentrations of methanolic extract from the mycelia in a range of 0.032–20.0 μg/ml and incubated at 37 °C for 72 h under similar culture conditions. Each experiment was carried out in triplicate and colchicine positive control was used as an inhibitor of cell division. Cell concentration was assessed using colorimetric method and sulforhodamine B. Results were expressed as percentage of cell growth using the formula of cellular growth (%) = (At - Ab) / (Ac - Ab) × 100. Where, At was the average OD of the treatment, Ac was the average OD of the control and Ab was the average of the initial growth OD (blank) [14]. 2.13. Statistical analysis Linear regression analysis of the semi-logarithmic graphs between the concentrations and percentages of the cell growth was used. Effective concentration of the compound needed to inhibit cell proliferation by 50% (IC50 in µg/ml) was assessed using Sigma plot software [15]. Results and Discussion 3.1. Fungus molecular identification Molecular identification of the fungi usually uses nuclear DNA markers (18S and 28S ribosomal genes), spacer regions such as ITS 1 and ITS 2, external ETS and IGS intergenic [16]. Although, most of the reports on fungi identification have used the ITS region. Several genomic regions within the ITS region have been standardized and are now referred to as DNA barcodes. These barcodes are short regions, typically 400–800 base pairs (bp) [17], facilitating molecular identification of fungi. This includes anamorphic fungi, which can particularly be challenging to identify [18]. In this study, the ITS4-ITS5 region was used, including ribosomal gene region of 5.8S (Fig. 1A). Fragment was achieved using ITS 4 forward and ITS 5 reverse primers, resulting in an amplicon of 450 bp within the expected range (Fig. 1B) [17]. Gimenez-Pereira et al. reported use of the ITS region to molecularly identify H. pseudokoningii within other filame-ntous fungi [19]. Then, the band obtained was cloned into the pJet 1.2 vector and sequenced using pJet forward and pJet reverse primers. Then, data were analyzed using Gen Bank database of the National Center for Biotechnology Information (NCBI), showing 99% identity and value of 0.0 with the sequence corresponding to H. pachybasioides (GU062213.1). This result helped molecular identification of the collected strain and a phylogenetic tree was construc-ted to show proximity of H. pachybasioides to other strains from similar species, demonstrating its close relationship majorly with other fungi of Trichoderma spp. (Fig. 2). 3.2. Chemically functional groups Compounds such as saponins, tannins, coumarins, alkaloids, anthraquinones in the methanolic extracts from the mycelia and filtered culture media of H. pachybasioides were assessed. All these compounds have been investigated in various organisms because they include pharmacological activities. For example, alkaloids have been used as anticancer, antimicrobial, antiparasitic, antidepressant, anti-malarial, anticonvulsant and antineurodegenerative agents. Anthraquinones are other molecules associated to antiviral, analgesic, diuretic, anticancer, anti-inflammatory, anti-microbial, antiparasitic, vasorelaxant and cathartic activities [20]. Furthermore, tannins may show antitumor, anti-microbial and antioxidant activities [21]. Coumarins have been reported to include anticancer, coagulant, antiedema, anti-hypertensive, anti-hypercholesterolemic, anticoagul-ant, antimicrobial, antiviral and antihypertensive activities [22]. Saponins have shown anticancer, antidiabetic, antiviral, antiallergic, antihypercholestero-lemic, antimicro-bial and antiparasitic activities [23]. Presence of these compounds in the methanolic extracts allowed the current authors to report the first approach on the chemical compounds produced by this fungus. In mycelia, presence of alkaloids was detected at a moderate concentration, while saponins and anthraquinones were detected at lower concentrations. However, the broth extract included a large quantity of saponins and alkaloids (Table 1). Presence of the chemically functional groups highly suggests that some might present a therapeutic activity. Organic acids such as ascorbic, D,L-malic, oxalic and tartaric were enriched in the broth extract, compared to the mycelia, and presented a similar magnification as the juice extracted from Stenocereus stellatus [13] [24]. 3.3. Total phenols and flavonoids quantifications Total phenols and flavonoids were quantified, which might include significant effects on cells [24]. Quantities of total phenols and flavonoids were lower in culture broth, compared to the extract from mycelia, both from a methanolic extract (Table 1). 3.4. Cytotoxic analysis To assess pharmacological activities, cytotoxic assess-ments were carried out using the methanolic extract from the mycelia on cell lines of MCF-7, HeLa and HCT15. So, the half maximal inhibitory concentration (IC50) was calculated by fitting curves of data from the sulforhodamine B assay (Table 1), where the antiproliferative effect was reported. Colchicine was used as control. Results showed that HeLa was the most sensitive cell line to the extract with an IC50 of 12.9 ppm while no activity was detec-ted in MCF-7 and HCT15 cells, less than 20 ppm in the assessed range. The IC50 was established as a criterion for cytotoxic activity of the crude extracts by the US national cancer institute; in which, range of 0-20 ppm is cytotoxic [25]. 3.5. Relationships between the chemical compounds and cytotoxic assay Use of fungi for the extraction of various compounds of nutritional and medicinal importance has extensively been studied. Although fungi are primary microorganisms producing metabolites, a few studies have focused on the analysis of chemically functional groups in the fungi. Compounds with pharmacological activity have already been identified and characterized. Saponins are used as compounds with antifungal activity such as strobilurins and oudesmansins present in basidiomycetes and ascomycetes. Endophytic fungi of medicinal plants such as Nectria, Aspergillus, Fusarium, Verticillium, Engyodontium, Plectosphaerella, Penicillium and Cladospori include these compounds, showing antifungal and antibacterial activities. Furthermore, these fungi are industrial materials to produce saponins with antimicrobial activity for use in health and agricultural sectors [26], It is noteworthy that these treatments are mostly used as mixtures. It is possible to improve effects of nano transporters [27]. It is well known that phenolics include antioxidant capacity. In this study, total phenolic compounds and flavonoids were assessed and the quantity was higher in mycelia than broth. In plants, most of the phenolics are in detected in the cytosol. This explains differences between the mycelia and broth extracts since the mycelial extract suffers cell disruption. It is useful to carry out studies on the antioxidant capacity of H. pachybasioides, as reported by Zeng et al., 2011 in two Hypocrea spp. [28]. Alkaloids include pharmacological activities such as antimicrobial, insecticidal, cytotoxic, vasoconstrictive, anti-hemorrhagic and anticancer activities. For example, ergometrine and ergoline from Claviceps spp. have shown vasoconstricting and anti-hemorrhagic activities and are used for migraine treatment. Oxalin extracted from P. oxalicum is an alkaloid with strong cytotoxic activity similar to taxol that is reported to arrest the cell cycle in M phase [29]. Reports of anthraquinones with pharmacological effects on fungi are little; however, tetrahydro-anthraquinone of Alternaria sp. XZSBG-1 has shown cytotoxic activity on cell lines of HCT-16 and HeLa while 6-8-di-O-methylveranthine isolated from A. versicolor EN-7 has shown antibacterial effects on E. coli and Staphylococcus aureus. Furthermore, T. aureoviride PSU-F95 produces two anthraquinones: coniotrantra-quinone-1 and emodine, which inhibit the growth of resistant strains of S. aureus [30]. These studies support results of the current study because with the extract from the mycelia, it was possible to report important cytotoxic activities for HeLa cell lines. Further studies are recommended to isolate specific metabolites in H. pachybasioides. Compounds with higher cytotoxic activities isolated from fungi are polysaccharides and heteropolysaccharides, which include high solubility in water and alcohols. These present better results when assessed with in vitro models on cancer cell lines [31]. The current results are aligned with this idea because it has been observed that methanolic extract of the H. pachybasioides mycelia includes antiproliferative activity for HeLa cell line. Trichoderma spp. produce such effects in Hela and HCT-7 cell lines [32]. Another important example is lipopeptaibols isolated from T. strigosum that have shown activity against various cell lines, including HCT-116 [33]. Cytotoxic activity of H. pachybasioides mycelia might be associated to high phenol contents, as occurs in S. stellatus extracts previously achieved in the current authors’ laboratory. It is suggested that phenols enhance antioxidant activity in cells. Correlations have been made between the cytotoxic effects and total phenols, antioxidant activities and cytotoxicity using the following formula: “Antioxidant capacity = a * phenols + b * D_malic + c * glucose; where, a = 0.54, b = 0.56, c = 0.28 (standard errors = 0.19, 0.20 and 0.21, respectively) and R = 0.76” [22]. This correlation with data was achieved from peels of tropical fruits: Annona squamosa L. (purple sugar apple), A. reticulata L. (custard apple), Chrysophyllum cainito L. (green star apple) and Melicoccus bijugatus Jacq. (mamoncillo) with a correlation with r2 = 0.97 (p = 0.05) with total phenols [24,34]. Conclusion In this study, a wild fungus was identified as H. pachybasioides using molecular approaches. A general study was carried out to assess various metabolites. It has been shown that methanolic extract from the myce

Growth of Synechococcus sp. immobilized in chitosan with different times of contact with NaOH

The thickness of the walls of the capsules of chitosan-immobilized Synechococcus cultures was dependent on the time of contact with NaOH and was directly related to culture growth. After an initial lag phase, probably caused by cell damage, the capsules obtained after 80 s in a 0.1 N NaOH solution showed better growth than that of free cell cultures (6.9 and 5.2 divisions in 10 days, respectively)