The outcomes measure of wide awake hand surgery

Objective: To measure the effects of WAHS intra-operatively with respect to subject’s well-being, pain and choice for wide awake surgery. Methodology: A cross sectional study of seventy patients with age range from 15-65 years, who underwent hand surgery in Jinnah Burn and Reconstructive Surgery Center, Lahore, between January 2019 to August 2019. The effectiveness of anesthesia was measured by pain, well-being and patient preferences. Pain was rated using the visual analogue scale (VAS). Patient well-being was tested depending on how they felt with respect to options on the Likert scale depicting in terms of extremely well, well, less well and extremely less well on VAS scoring. The preference of the subject was assessed by his experience in the surgery and the anesthesia they chose. Results: The total number of patients was 70, whose age was 33.63±6.94 in the range of 15 to 65 years. The average pain score on the VAS was 0.51±1.38 and the duration of surgery was 1.43±0.35 hours. Pain was a variation in the outcome observed in operation during surgery. There were 84.3% of patients who did not experience any pain during their surgery. The remaining patients showed various levels of pain on VAS. Conclusion: The benefits of WAHS are that short duration hand surgery procedures can be done using local anesthesia containing epinephrine. It is cost effective, avoids the side effects of general anesthesia, avoids the use of a tourniquet and reduces the burden of surgical patients requiring general or regional anesthesia procedure. It also avoids patient admission in to the hospital thus sparing hospital beds

Association between ultra-processed foods and recurrence of depressive symptoms: the Whitehall II cohort study

OBJECTIVES: To examine the association between high intakes of ultra-processed foods (UPF) and recurrence of depressive symptoms (DepS) in a Western non-Mediterranean country and its contribution to the overall diet-depression relationship. METHODS: Analyses were carried out on British participants from the Whitehall II cohort. Present analyses were restricted to white participants N = 4554 (74% men, mean age = 61; SD = 5.9). UPF consumption was estimated from a 127-item food frequency questionnaire using the NOVA classification, and cumulative average of UPF intakes (g/day) over 11 years of exposure (1991/1994-2002/2004) was computed. Recurrent DepS after measurement of UPF was defined as having two or more episodes of DepS (the Center for Epidemiologic Studies Depression Scale (CES-D) score ≥ 16 or antidepressants use) during four phases of follow-up (2002/2004-2015/2016). RESULTS: Over the follow-up, 588 (12.9%) cases of recurrent DepS were observed. After adjusting for socio-demographic factors, health behaviours and health status, participants in top quintile of UPF intakes [mean 33% of total daily intakes in grams] had 31% higher odds of recurrent DepS (odds ratio 1.31; 95% CI 1.04-1.64) compared to participants in the four lowest quintiles of UPF [mean 18.1% of total daily intakes in grams]. Additional analyses showed that associations between adherence to several diet quality measures and recurrent DepS were partially attenuated (17-27%) by UPF intakes. CONCLUSION: In this British population, high intakes of ultra-processed foods were associated with increased odds of recurrent depressive symptoms and contributed to the overall diet quality-depressive symptoms association

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Seasonal influence, heat unit accumulation and heat use efficiency in relation to maize grain yield in Pakistan

Variations in ambient temperature affect crop yield by modifying the duration of phenological phases and physiologicalprocesses. An experimental study was carried out at the Maize and Millets Research Institute (MMRI),Yusafwala, Sahiwal, Pakistan, to determine the seasonal effects of temperature on indigenous and exotic maize(Zea mays L.) hybrids based on morphological, phenological, physiological and grain quality traits in four differentgrowing seasons: kharif 2016 and 2017, and spring 2017 and 2018. Seven indigenous and three exotic hybridswere sown in a randomized complete block design with a split plot arrangement, in three replications. Significantdifferences between hybrids and growing seasons were found for grain yield, related traits and temperature indices(cumulative heat units, photothermal index and heat use efficiency). Correlation analysis disclosed a significantpositive relationship between grain yield and net photosynthetic rate (0.854, P≤0.01), number of grains per ear(0.624, P≤0.01) and heat use efficiency (0.980, P≤0.01) in spring seasons. During kharif, net photosynthetic rate(0.675, P≤0.01) and heat use efficiency (0.996, P≤0.01) contributed significantly to grain yield, whereas number ofgrains per ear (−0.146, not significant) had no significant impact on grain yield. Cumulative heat units and heat useefficiency resulted the temperature indices with the greatest influence on grain yield, and should be consideredduring the selection of parents to develop high-yielding, climate-smart maize hybrids. Indigenous maize hybridsshowed higher yields and were more heat tolerant than exotic hybrids, and the spring sowing season appearedto be the most suitable for the cultivation of maize crops

Factors Determining Pakistani Medical Students\u27 Career Preference for General Practice Residency Training.

Background Few studies have explored factors affecting preference of medical students towards general practice as a career choice. We conducted a survey in Karachi across various public and private sector medical colleges to examine factors associated with students’ general practice career aspirations in Karachi, Pakistan. Methods From January to March 2018, we distributed a 21-item questionnaire to final year medical students in eight medical schools. The survey asked students about their top three career preferences from 19 specialty fields, their demographics and their career priorities. Multivariable logistic regression was used to determine the effect of each item. Results A total of 1400 responses were obtained. The top five specialty fields chosen by students with their numbers were: internal medicine, 898 (64.2%); general practice, 337 (24.1%); pediatrics, 449 (32.1%); surgery, 380 (27.2%); and emergency medicine, 243 (17.4%). The “intent to inherit existing practice” and “other academic or professional experiences prior to medical school” had a positive association with choosing general practice while “having a physician parent’’ had a negative association among the medical students demographics after adjusting for other covariates in the multivariable logistic regression. Medical students who ranked “clinical diagnostic reasoning”, “community-oriented practice”, “involvement in preventive medicine”, and “frequent patient communication” as highly important were more likely to choose general practice, whereas, “access to advanced medical fields”, “mastering advanced procedures”, and “depth rather than breadth of practice” were less likely to be associated with general practice aspiration. Conclusion The study’s results depicted limited interest of family medicine as a career option in graduating students, and pointed out the factors that likely influence the choice of general practice as a career are clinical diagnostic reasoning, community-oriented practice and preventive medicine

Etude étiologique des associations entre alimentation et symptômes dépressifs

La dépression touche plus de 280 millions de personnes dans le monde et constitue la première cause d'invalidité. La litterature scientifique rapporte une association robuste entre la qualité de l'alimentation et la réduction des troubles dépressif. Toutefois, des recherches sont nécessaires pour mieux comprendre l'étiologie des associations entre alimentation-dépression et identifier les recommandations alimentaires les plus efficaces pour prévenir les troubles dépressifs.En exploitant les données de la cohorte prospective britannique Whitehall II incluant des hommes et des femmes fonctionnaires (n=10,308, 66.9% men, âgés entre 35-55 ans en 1985-88), nous avons pu observer une association entre consommation élévée d'aliments ultra- transformés (AUT) et récurrence de symptômes dépressifs (SDep). Nous avons également montré que l'adhérence au régime MIND -indice alimentaire developpé pour prévenir le déclin cognitif- était associé à la recurrence des SDep, et identifié les composants les plus fortement associés : légumes verts, fruits rouges et aliments frits.Enfin, nous avons identifié le profil métabolique (mesuré par résonnance magnétique nucléaire) associé au régime MIND (25 métabolites) et pu montrer que parmi ces métabolites, l'acétyl glycoprotéine et les acides gras polyinsaturés (AGPI) -plus spéifiquement les oméga-3 et l'acide docosahexaénoïque (ADH)-, étaient associés au risque de survenue de SDep.Mes travaux ont contribué à enrichir le champ de recherche dédié à la psychiatrie nutritionnelle, (i) en suggérant l'importance des AUT en regard des SDep - une dimension non consiédée dans les scores alimentaires classiques; (ii) en montrant que les recommendations destinées à prévenir le déclin cognitif pouvaient également être pertinentes pour la récurrence des SDep; (iii) en examinant la triade alimentation- métabolites-dépression et en identifiant les AGPI (omega-3 et ADH) et l'acétyl glycoproétine comme potentiels biomarqueurs de la relation alimentation- troubles dépressifs.Depression affects 280 million people, and is one of the major contributor to the global burden of disease. While literature evidenced robust association between diet quality and risk of depressive outcomes, the etiological pathway linking diet to depression as well as the most optimal diet to prevent depressive disorders remain to be further investigated.Using data from the ongoing Whitehall II prospective cohort study including British men and women civil servants (n=10,308, 66.9 % men, aged 35-55 years in 1985- 88), we first reported that high intakes of UPF were associated with increased odds of recurrent depressive symptoms (DepS) independently of socio-economic, health behaviors and health related status factors. Second we showed that dietary index designed to capture cognitive health - the MIND diet- was also found to be associated with recurrent DepS and identified green leafy vegetables, berries and low consumption of fried foods as the food components the most strongly associated with DepS. Third, we examined whether the metabolomicprofile (assessed via nuclear magnetic resonance) associated with MIND diet was also predicting the onset of DepS. Of the 25 metabolites significantly associated with adherence to MIND diet, glycoprotein acetyl (inflammatory marker), and polyunsaturated fatty acids (PUFA) -especially omega-3 and docosahexaenoic acid (DHA)- were the metabolites found to be significantly associated with onset of DepS.Our findings bring new evidence in the field of nutritional psychiatry by (i) highlighting the possible deleterious effect of UPF -an item not accounted in traditional dietary indice score- on depression physiopathology (ii) by showing that the dietary guideline designed to capture cognitive health was also significantly associated with recurrence of DepS (iii) by examining in an observational framework the triad diet- metabolites- DepS, my PhD work shed lights on specific metabolites -PUFA (omega 3 and DHA), and glycoprotein acetyl- as potential biomarkers of the diet-DepS association