Enforced Expression of Bcl-2 Selectively Perturbs Negative Selection of Dual Reactive Antibodies

We investigated the role of apoptosis in the development of B cell memory by analyzing the (p-azophenylarsonate) Ars response in a line of A strain mice in which expression of human Bcl-2 was enforced in the B cell compartment. Previous studies of the Ars immune response in these A. Bcl-2 mice, demonstrated that a large percentage of the antibodies expressed by the Ars induced memory B cell compartment had accumulated point mutations via somatic hypermutation that increased their affinity for both Ars and the autoantigen DNA (“dual reactive” antibodies). This was in sharp contrast to normal A strain mice which displayed no dual reactive B cells in their Ars induced memory B cell compartment. These data suggested that interference with apoptotic pathways regulated by Bcl-2 allows developing memory B cells that have acquired autoreactivity to bypass a peripheral tolerance checkpoint. Further studies of these mice, reported here, demonstrate that enforced expression of Bcl-2 does not alter serum antibody affinity maturation nor positive selection of B cells expressing somatically mutated antibody with an increased affinity for Ars. Moreover, the somatic hypermutation process was unaffected in A. Bcl-2 mice. Thus, enforced expression of Bcl-2 in A. Bcl-2 mice appears to selectively alter a negative selection process that operates during memory B cell differentiation

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro

In vitro processing of cucumber chloroplast tRNA Leu(CAA) precursor in a pea chloroplast soluble extract

To study the sequential steps in the processing pathway of the chloroplast monocistronic intronless tRNA precursors, we examined cucumber chloroplast tRNA(Leu)(CAA) processing in a cucumber or pea chloroplast soluble extract. The tRNA(Leu)(CAA) precursor synthesized from SP6 RNA polymerase-directed transcription system, was used as a substrate. Incubation of the tRNA precursor with the pea extract resulted in processing of tRNA(Leu)(CAA) via 5'- and 3'-endonucleolytic cleavages followed by final trimming of extra 3' nucleotides by 3' exonuclease(s). No preferred order for endonucleolytic cleavages has been observed during the in vitro tRNA(Leu) processing and the simultaneous occurrence of the intermediates consisting of leader + tRNA(Leu) and tRNA(Leu) + trailer, indicate that either 5'- or 3'-endonucleolitic cleavage can occur as the first step in vitro

Variations in the levels of aminoacylation and modified nucleotide content between total tRNAs from chloroplasts and etioplasts in cucumber cotyledons

Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect toamino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis(2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1 -methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNAmodifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications