Laservaporisation der Prostata: Aktueller Stellenwert des Greenlight- und Diodenlasers

Zusammenfassung: Die Laservaporisation der Prostata hat sich in den letzten 10Jahren als sichere und effektive Alternative zur TURP etabliert. Die photoselektive Vaporisation der Prostata (PVP) hat seit der Einführung des 532nm 80-W-KTP-Lasers im Jahr 2002 maßgeblich zu dieser Entwicklung beigetragen. Ergebnisse prospektiv randomisierter Studien zu PVP und TURP mit einem maximalen Beobachtungszeitraum von 3Jahren zeigen mehrheitlich vergleichbare funktionelle Resultate. Zahlreiche Kohortenstudien belegen zudem die sichere Anwendung der PVP bei Patienten unter oraler Antikoagulation sowie bei großem Prostatavolumen. Zur Laservaporisation der Prostata mit dem Diodenlaser stehen Systeme verschiedener Hersteller zur Verfügung, welche sich in maximaler Laserleistung und Wellenlänge unterschieden. Daher kann nicht von dem Diodenlaser per se gesprochen werden. Bisher fehlen zu Diodenlasern Resultate prospektiv randomisierter Studien im Vergleich mit TURP. In Kohortenstudien oder Vergleichsstudien zur PVP zeichnet sich der Diodenlaser v.a. durch eine ausgeprägte Hämostase aus. Bezüglich der funktionellen Resultate zeigt sich ein uneinheitliches Bild mit teilweise hohen Reoperationsrate

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

Living systematic review and meta-analysis of the prostate MRI diagnostic test with Prostate Imaging Reporting and Data System (PI-RADS) assessment for the detection of prostate cancer:study protocol

INTRODUCTION: The Prostate Imaging Reporting and Data System (PI-RADS) standardises reporting of prostate MRI for the detection of clinically significant prostate cancer. We provide the protocol of a planned living systematic review and meta-analysis for (1) diagnostic accuracy (sensitivity and specificity), (2) cancer detection rates of assessment categories and (3) inter-reader agreement. METHODS AND ANALYSIS: Retrospective and prospective studies reporting on at least one of the outcomes of interest are included. Each step that requires literature evaluation and data extraction is performed by two independent reviewers. Since PI-RADS is intended as a living document itself, a 12-month update cycle of the systematic review and meta-analysis is planned. This protocol is in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses—Protocols statement. The search strategies including databases, study eligibility criteria, index and reference test definitions, outcome definitions and data analysis processes are detailed. A full list of extracted data items is provided. Summary estimates of sensitivity and specificity (for PI-RADS ≥3 and PI-RADS ≥4 considered positive) are derived with bivariate binomial models. Summary estimates of cancer detection rates are calculated with random intercept logistic regression models for single proportions. Summary estimates of inter-reader agreement are derived with random effects models. ETHICS AND DISSEMINATION: No original patient data are collected, ethical review board approval, therefore, is not necessary. Results are published in peer-reviewed, open-access scientific journals. We make the collected data accessible as supplemental material to guarantee transparency of results. PROSPERO REGISTRATION NUMBER: CRD42022343931

The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of alpha 1-adrenergic contraction

Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1

Using Creative Methodology to Explore LGBTQ+ Love and Relationship Experiences across the lifespan:Developing Inclusive and Healthy Spaces through Positive Intergenerational Exchange

Introduction: Important lessons can be learned from the intergenerational sharing of lifetime love and relationship stories between multigenerational LGBTQ+ people, to inform education, healthcare, and policy. However, such exploratory studies have been limited. The aim of this co-creation study was to explore younger and older peoples’ LGBTQ+ love and relationship experiences using creative methodology.Methods: Three 2-hour virtual fictional writing and storytelling workshops were conducted at the height of the COVID-19 pandemic in Edinburgh, Scotland. Participants included 2 middle-aged adults; 3 older adults aged 55+; and 5 youths who identified as either lesbian, gay, bisexual, transgender or queer. Participants’ stories were audio-recorded, transcribed and thematically-analyzed to capture understandings of intergenerational knowledge exchange and LGBTQ+ love and relationships across sociocultural and environmental contexts. Diverse experiences were unpacked and shared through a self-reflexive creative writing process.Findings: Participants identified the act of storytelling and fictional writing as particularly liberating, providing a platform for voice and reflexivity. The reflexive analysis highlighted the importance of reflexivity and the careful navigation of intersectionality and power within research contexts. Our introspective analysis resulted in valuable future directions for employing creative methodologies to further explore diverse experiences within LGBTQ+ research.Conclusions: Participants reported that being able to craft their stories was a freeing experience, enabling sense-making to occur. Using creative methodology was demonstrated as an effective way to facilitate intergenerational engagement, and bring to light the complexities of LGBTQ+ love and relationships across generations in a safe environment

Leveraging Entrepreneurial Ambition and Innovation : A Global Perspective on Entrepreneurship, Competitiveness and Development

The study described in this report combines two unique datasets, the World Economic Forum’s Global Competitiveness Index data, which ranks the economic competitiveness of 144 economies, and Global Entrepreneurship Monitor’s assessment of entrepreneurial activity across 70 economies. Using five years of data from both sets, the study analyses a sample of 44 economies by first examining three aspects of entrepreneurial activity, then grouping economies into five types of entrepreneurial clusters, and finally developing a deeper understanding of each type of cluster. Lastly, the study delves into what policymaking best benefits the unique characteristics of different economies