N-linked Glycosylation Is Required for Optimal Function of Kaposi's Sarcoma Herpesvirus–encoded, but Not Cellular, Interleukin 6

Kaposi's sarcoma–associated herpesvirus interleukin-6 (vIL-6) is a structural and functional homologue of the human cytokine IL-6 (hIL-6). hIL-6 and vIL-6 exhibit similar biological functions and both act via the gp130 receptor subunit to activate the Janus tyrosine kinase (JAK)1 and signal transducer and activator of transcription (STAT)1/3 pathway. Here we show that vIL-6 is N-linked glycosylated at N78 and N89 and demonstrate that N-linked glycosylation at site N89 of vIL-6 markedly enhances binding to gp130, signaling through the JAK1-STAT1/3 pathway and functions in a cytokine-dependent cell proliferation bioassay. Although hIL-6 is also N-glycosylated at N73 and multiply O-glycosylated, neither N-linked nor O-linked glycosylation is necessary for IL-6 receptor α–dependent binding to gp130 or signaling through JAK1-STAT1/3. As distinct from vIL-6, unglycosylated hIL-6 is as potent as glycosylated hIL-6 in stimulating B cell proliferation. These findings highlight distinct functional roles of N-linked glycosylation in viral and cellular IL-6

Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5′ AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5′ GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3′ end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins

Upregulation of STAT3 Marks Burkitt Lymphoma Cells Refractory to Epstein-Barr Virus Lytic Cycle Induction by HDAC Inhibitors▿

A fundamental problem in studying the latent-to-lytic switch of Epstein-Barr virus (EBV) and the viral lytic cycle itself is the lack of a culture system fully permissive to lytic cycle induction. Strategies to target EBV-positive tumors by inducing the viral lytic cycle with chemical agents are hindered by inefficient responses to stimuli. In vitro, even in the most susceptible cell lines, more than 50% of cells latently infected with EBV are refractory to induction of the lytic cycle. The mechanisms underlying the refractory state are not understood. We separated lytic from refractory Burkitt lymphoma-derived HH514-16 cells after treatment with an HDAC inhibitor, sodium butyrate. Both refractory- and lytic-cell populations responded to the inducing stimulus by hyperacetylation of histone H3. However, analysis of host cell gene expression showed that specific cellular transcripts Stat3, Fos, and interleukin-8 (IL-8) were preferentially upregulated in the refractory-cell population, while IL-6 was upregulated in the lytic population. STAT3 protein levels were also substantially increased in refractory cells relative to untreated or lytic cells. This increase in de novo expression resulted primarily in unphosphorylated STAT3. Examination of single cells revealed that high levels of STAT3 were strongly associated with the refractory state. The refractory state is manifest in a unique subpopulation of cells that exhibits different cellular responses than do lytic cells exposed to the same stimulus. Identifying characteristics of cells refractory to lytic induction relative to cells that undergo lytic activation will be an important step in developing a better understanding of the regulation of the EBV latent to lytic switch