Étude cytologique et physiologique du protozoaire Tetrahymena pyriformis exposé au Triton X-100

En ce qui concerne les plus récentes études toxicologiques le regroupement d’un ensemble d’essais biologiques, au lieu de l´évaluation d’un seul paramètre, peu mieux refléter la toxicité des contaminants à différents niveaux d’organisation biologique. Le présent travail est consacré à l´évaluation de la cytotoxicité d’un surfactant neutre dérivé de l’oxyde d’éthylène, abondamment utilisé dans le milieu industriel, le Triton X-100, sur le protozoaire cilié Tetrahymena pyriformis. Nous proposons ainsi l’utilisation innovatrice d’une batterie de tests morphologiques, structurels, physiologiques et biochimiques qui nous fournisse une information globale de l’effet toxicologique du surfactant. Les altérations morphologiques et l´évaluation de la croissance de l’organisme test sont les essais biologiques plus utilisés par la simplicité de leur réalisation et de leur reproductibilité en laboratoire. Par ailleurs, l’essai de croissance d’une population représente un paramètre de toxicité sub-létale qui ne demande pas d’expertise technique particulière. L’analyse morphométrique de la cellule à permis la détermination de l’aire cellulaire e du ratio entre l’axe majeur et l’axe mineur de l’organisme. L’utilisation de l’analyse d’image a été indispensable en ce qui concerne la réduction de temps disposé pour le traitement de centaines d’images. Les techniques usant des marqueurs fluorescents se sont présenté comme des essais flexibles et sensibles, prouvant leur efficacité dans l’étude cytotoxicologique envers Tetrahymena pyriformis. Ces techniques ont été utilisées à l’essai d’immunofluorescence par microscopie confocale, en ce qui concerne l’observation de changements au niveau du cytosquelette, mais aussi à l’essai de viabilité (l’essai CAM/EthD-1) et à l’essai d’ingestion de microsphères de latex. Ce dernier infère sur l’état physiologique de l’individu exposé au contaminant. La cytométrie de flux est une technique avancée qui permet la quantification de la fluorescence émette par les marqueur cellulaires de viabilité, détectant d’une forme plus précise et objective, des changements subtils qui ne sont pas observable par la microscopie d’épifluorescence. L’essai de réduction du MTT a été utilisé comme une méthode alternative à la détermination de la viabilité de Tetrahymena pyriformis exposé au Triton X-100

New insights for identification of clinical isolates of Trichophyton rubrum using MALDI-TOF MS

Dermatophytoses are the most common fungal infection worldwide with a nondespicable impact in health-care costs. Trichophyton rubrum is an antropophilic dermatophyte species very well adapted to human host causing chronic and slowly progressing disease on keratinised tissues. It is the causative agents of about 70% of all human dermatophytoses. Besides their distribution all over the world this species is by far, the most frequently isolated species on onychomycosis and tinea pedis. Matrix Assisted Laser Desorption Ionisation Time of Flight Mass Spectrometry (MALDI-TOF MS) analysis has already been used as a rapid technique in the identification and classification of microorganisms. It has progressively been incorporated as a technique in the polyphasic approach to improve the accuracy of the microbial identification issue. This technique has also been used as a tool for the fast identification of filamentous fungi with clinical relevance including dermatophytes. In this study twenty clinical dermatophyte isolates were analysed using a polyphasic approach that was based on macro- and micro-morphologies, biochemistry, molecular biology using ITS 1-4 sequencing data and primers M13, (GACA)4 and (AC)10 for typing and, MALDI-TOF MS analyses. Eighteen of these clinical dermatophyte isolates were collected from human nails. The remaining 2 isolates were the reference strain T. rubrum ATCC MYA-4438 that was used as positive control and the strain T. mentagrophytes ATCC MYA-4439 that was used as out-group. Preliminary results based on macroand micro-morphologies indicated that all isolates were T. rubrum. These results were confirmed by molecular biology and MALDI-TOF MS techniques. For molecular approach 16 T. rubrum isolates were clustered in a single group with 100% of genotypic homology of the ITS1-4 region. Moreover, 2 remaining T. rubrum isolates were found having 98% of homology in this region. Similar clusters were found for M13 and (GACA)4 primers. In contrast, (AC)10 was not discriminative. MALDI-TOF MS analysis corroborates with morphological and molecular identifications. Nine T. rubrum isolates were clustered on a single group evidencing 100% similarity and the remaining T. rubrum isolates were distributed over the MALDI-TOF MS dendrogram showing phenotypic variability. MALDI-TOF MS shown to be as good as molecular biology and, moreover, rapid, low-cost and accurate alternative tool for identification and strain typing of T. rubrum clinical isolates. Analysis of mass spectra profiles provided new insights in the proteomic approach for strain typing of clinical isolates of T. rubrum. As a matter of consequence, MALDI-TOF MS can be suitable as point-of-care diagnostic for dermatophytoses.European Community’s Seventh Framework Programme (FP7, 2007-2013), Research Infrastructures action, under the grant agreement No. FP7-228310 (EMbaRC project

Étude de cytotoxicologie in vitro en Tetrahymena pyriformis exposé aux colorants azo

La croissante pollution de l’environnement associée à une production persévérante de nouvelles substances chimiques a déclenché une préoccupation croissante en se qui concerne leurs effets toxiques directs ou indirects vis-à-vis de la santé publique. Les contaminants rejetés dans l’environnement finissent par se retrouver plus ou moins rapidement dans les milieux aquatiques où ils peuvent avoir des effets à cours et à long terme. Les colorants du type azo sont fréquemment utilisés en raison de leurs bas coûts de production. Par ailleurs, l’assortiment des applications industrielles de ces produits est un autre facteur à tenir conte. Néanmoins, de larges quantités de ces colorants sont rejetées dans l’environnement à travers des effluents industriels et sa dispersion dans le milieu cause beaucoup de problèmes. Il est urgent de combattre leurs effets toxiques, leurs action sur l’environnement, et encore, leurs permanence comme des substances récalcitrantes. En ce qui concerne les altérations provoquées à l’environnement par l’introduction de substances toxiques, l’écotoxicologie apparaît comme un recours, intervenant pour une meilleure connaissance des mécanismes d’actuation dans le milieu. Cependant il est déterminant de connaître les effets des perturbations de ces substances en un individu isolé. De ce fait, les protozoaires sont un excellent outil de travail pour les études de toxicité et de la pollution aquatique. En laboratoire, le protozoaire cilié Tetrahymena pyriformis est l’un des organismes test plus étudié. Par ailleurs, cet organisme est utilisé dans ce travail comme un bio-indicateur a propos de l’étude de ces réponses physiologiques et biochimiques de Tetrahymena pyriformis à la présence de huit colorants azo provenant de l’industrie textile, à de différentes concentrations. On propose donc l’utilisation d’une batterie de bioessais toxicophysiologiques, comme la croissance, la mortalité, la prédation; et les bioessais biochimiques (ATP). L’objectif final de cette étude est de collecter des données pour comparer les réponses vis-à-vis de la présence de différentes concentrations du même colorant. L’utilisation d’une batterie de tests, représente un moyen innovateur en ce qui concerne la détermination de la toxicité de ces colorants

Is MALDI-TOF ICMS able to discriminate dermatophyte clones?

The affinity for keratinised tissues by dermatophytes implies in most of the cases, that the infection remains restricted to the nonliving cornified layers of the skin, nails, and hair. Among dermatophytes, the species Trichophyton rubrum is of particular clinical interest because it is the most common agent of human dermatophytoses. Matrix Assisted Laser Desorption Ionization Time of Flight Intact Cell Mass Spectrometry (MALDl-TOF ICMS) analysis has already been used as a rapid technique in the identification and classification of microorganisms. It has also been incorporated as an additional technique in the polyphasic approach to improve the accuracy of the microbial identification issue. In this study, twenty clinical isolates of T rubrum from the human nails were analysed using a polyphasic approach that was based on macro- and micro- morphologies, biochemistry, molecular biology using Trubrum-for (5'TCTTTGAACGCACATTGCGCC3') and Trubrum-rev (5'CGGTCCTGAGGGC GCTGAA3') primers and MALDl-TOF ICMS analyses. All T. rubrum identifications were confirmed by these applied techniques. Additionally, nine isolates were grouped together as "clones" by MALDl-TOF ICMS. In order to clarify if spectral results have any correspondence to the molecular data, primer M13 (5'GAGGGTGGCGGTTCT3') was used to typing these isolates. Surprisingly, the molecular biology data corroborate to those found by MALDl-TOF ICMS concerning the occurrence of clones. This findings needs to be studied more in detail using other primers for expand the typing studies

Evaluation by flow cytometry of Escherichia coli viability in lettuce after disinfection

Foodborne outbreaks due to the consumption of ready-to-eat vegetables have increased worldwide, with Escherichia coli (E. coli) being one of the main sources responsible. Viable but nonculturable bacteria (VBNC) retain virulence even after some disinfection procedures and constitute a huge problem to public health due to their non-detectability through conventional microbiological techniques. Flow cytometry (FCM) is a promising tool in food microbiology as it enables the distinction of the different physiological states of bacteria after disinfection procedures within a short time. In this study, samples of lettuce inoculated with E. coli were subject to disinfection with sodium hypochlorite at free chlorine concentrations of 5, 10, 25, 50, and 100 mg·L1 or with 35% peracetic acid at concentrations of 5, 10, 25, and 50 mg·L1. The efficiency of these disinfectants on the viability of E. coli in lettuce was evaluated by flow cytometry with LIVE/DEAD stains. Results from this study suggest that FCM can effectively monitor cell viability. However, peracetic acid is more effective than sodium hypochlorite as, at half the concentration, it is enough to kill 100% of bacteria and always induces a lower percentage of VBNC. Finally, we can conclude that the recommended levels of chemical disinfectants for fresh fruit and vegetables are adequate when applied in lettuce. More importantly, it is possible to ensure that all cells of E. coli are dead and that there are no VBNC cells even with lower concentrations of those chemicals. These results can serve as guidance for lettuce disinfection, improving quality and the safety of consumption.This research was supported by the Portuguese Foundation for Science and Technology (FCT) under the scope of the strategic funding of UID/BIO/04469/2019 unit and BioTecNorte operation (NORTE‐01‐0145‐ FEDER‐000004) funded by the European Regional Development Fund under the scope of Norte2020‐Programa Operacional Regional do Norte. Pilar Teixeira acknowledges FCT for grant SFRH/BPD/86732/2012.info:eu-repo/semantics/publishedVersio

Evaluation of lipid extraction methods from Antarctic filamentous fungi

Purpose: The benefits of natural compounds have been studied for decades for the development of new technologies to answer the global change challenges. In order to develop these new technologies, lipids represent a great class of bioactive molecules. However, the research on lipids and their applications still present gaps about new sources as well as on the extraction methods. Filamentous fungi found in Antarctic territory could represent a new source of novel bioactive lipids. Currently Folch, Bligh & Dyer and Lewis methods are the most widely employed for extraction of lipid from different sample types. Nonetheless, choosing a single extraction method as the gold standard could represent a limitation, especially when the microorganism has not been studied yet. Taking the above into consideration, the main objective of the present study was to evaluate the best extraction method to obtain lipids from different Antarctic filamentous fungal genera. Material and methods: Three isolates of Antarctic fungi belonging to each genus: Mucor, Mortierella, Cladosporium, Penicillium and Pseudogymnoascus isolates from Fildes Bay, Antarctica, were evaluated. A total of 15 isolates were assessed. Folch, Bligh & Dyer and Lewis extraction method were performed. Extraction was monitored by recording spectra of FT-IR spectroscopy of the biomass before and after lipid extraction. Results: Folch was the best method to obtain lipids from filamentous Antarctic fungi, followed by Lewis extraction. Among the three extraction methods evaluated, Bligh & Dyer was the method that presented the lowest yield, compared to Folch and Lewis for each genus and strain. Strains of the genera Mortierella and Mucor were the ones that showed the best performance for the Folch and Lewis methods. The three Penicillium isolates were the third group with the best lipids yield for the Folch method. The strains of genera Cladosporium and Pseudogymnoascus showed better yields for the Lewis method. Conclusions: In this study it was observed that the lipids yield varies according to the extraction methods, as well as both the fungal isolate and fungal genus. Depending on the purpose and fungi taxa, to obtain lipids from Antarctic fungi Folch or Lewis extraction methods are recommended.info:eu-repo/semantics/publishedVersio

A novel flow cytometry assay based on bacteriophage-derived proteins for Staphylococcus detection in blood

Bloodstream infections (BSIs) are considered a major cause of death worldwide. Staphylococcus spp. are one of the most BSIs prevalent bacteria, classified as high priority due to the increasing multidrug resistant strains. Thus, a fast, specific and sensitive method for detection of these pathogens is of extreme importance. In this study, we have designed a novel assay for detection of Staphylococcus in blood culture samples, which combines the advantages of a phage endolysin cell wall binding domain (CBD) as a specific probe with the accuracy and high-throughput of flow cytometry techniques. In order to select the biorecognition molecule, three different truncations of the C-terminus of Staphylococcus phage endolysin E-LM12, namely the amidase (AMI), SH3 and amidase+SH3 (AMI_SH3) were cloned fused with a green fluorescent protein. From these, a higher binding efficiency to Staphylococcus cells was observed for AMI_SH3, indicating that the amidase domain possibly contributes to a more efficient binding of the SH3 domain. The novel phage endolysin-based flow cytometry assay provided highly reliable and specific detection of 15 CFU of Staphylococcus in 10mL of spiked blood, after 16hours of enrichment culture. Overall, the method developed herein presents advantages over the standard BSIs diagnostic methods, potentially contributing to an early and effective treatment of BSIs.This study was supported by the Portuguese Foundation for Science and Technology (FCT) under the scope of the project Phages-on-chip PTDC/BTM-SAL/32442/2017 (POCI-01-0145-FEDER-032442) and the strategic funding of UID/BIO/04469/2019 unit and BioTecNorte operation (NORTE-01-0145-FEDER-000004) funded by the European Regional Development Fund under the scope of Norte2020 - Programa Operacional Regional do Norte. Susana Costa was supported by the grant SFRH/BD/130098/2017 from FCT. We would also like to acknowledge Professor Hermínia de Lencastre, Doctor Carina Almeida, and Doctor Nuno Cerca for gently providing some of the strains used in this study. We acknowledge Professor Paulo Freitas for providing some ohf the infrastructures to perform the experiments.info:eu-repo/semantics/publishedVersio

New textile for personal protective equipment—plasma chitosan/silver nanoparticles nylon fabric

Fabric structures are prone to contamination with microorganisms, as their morphology and ability to retain moisture creates a proper environment for their growth. In this work, a novel, easily processed and cheap coating for a nylon fabric with antimicrobial characteristics was devel- oped. After plasma treatment, made to render the fabric surface more reactive sites, the fabric was impregnated with chitosan and silver nanoparticles by simply dipping it into a mixture of different concentrations of both components. Silver nanoparticles were previously synthesized using the Lee–Meisel method, and their successful obtention was proven by UV–Vis, showing the presence of the surface plasmon resonance band at 410 nm. Nanoparticles with 25 nm average diameter observed by STEM were stable, mainly in the presence of chitosan, which acted as a surfactant for silver nanoparticles, avoiding their aggregation. The impregnated fabric possessed bactericidal activ- ity higher for Gram-positive Staphylococcus aureus than for Gram-negative Pseudomonas aeruginosa bacteria for all combinations. The percentage of live S. aureus and P. aeruginosa CFU was reduced to less than 20% and 60%, respectively, when exposed to each of the coating combinations. The effect was more pronounced when both chitosan and silver were present in the coating, suggesting an effective synergy between these components. After a washing process, the antimicrobial effect was highly reduced, suggesting that the coating is unstable after washing, being almost completely removed from the fabric. Nevertheless, the new-coated fabric can be successfully used in single-use face masks. To our knowledge, the coating of nylon fabrics intended for face-mask material with both agents has never been reported.This study was supported by the Portuguese Foundation for Science and Technology (FCT), under the scope of the strategic funding of UIDB/04469/2020 unit, and BioTecNorte operation (NORTE-01-0145-FEDER-000004). funded by the European Regional Development, Fund under the scope of Norte2020—Programa Operacional Regional do Norte

Characterisation of different Chilean Capsicum spp. varieties and the antifungal activity of their aqueous extracts

The increase in fungal resistance to synthetic antifungals used in agrifood production has brought the need to develop new technologies based on an eco-friendly approach. The main aim of this work was to evaluate the antifungal potential of Chilean Capsicum spp. extracts against plant pathogens and mycotoxigenic fungi found in agrifood production. Five different varieties of Chilean Capsicum spp. were obtained from both farmers and local markets in the city of Temuco, Chile. A specialist Botanist at the Universidad de La Frontera (Chile) confirmed the identification of pepper species and varieties. Fresh samples were grounded with a blender and freeze-dried for 7 days in the dark. After that, dry powder samples were stored at -20 °C in the dark until use. Pepper pod aqueous extracts were obtained by blending the freeze-dried puree from Capsicum spp. with 300 mL distilled water. Samples were incubated at 90°C for 20 minutes in a water bath with intermittent cycles of manual stirring every 2 minutes. The determination of capsaicinoid content was performed on an HPLC-FD system and the total polyphenols content was performed on an HPLC-DAD system. The antioxidant activity was carried out in a microplate reader using the DPPH and CUPRAC method. Reference strains of Alternaria, Aspergillus, Fusarium, Penicillium and Rhizopus were subjected to susceptibility tests (disc and culture media diffusion methods and MIC assay) against different concentrations of each pepper pod extract. Pure capsaicin, dihydrocapsaicin, nordihydrocapsaicin and amphotericin B were used as standard in the susceptibility tests. Significant differences in the concentration of capsaicinoids were found among the different varieties of the same Capsicum species. The pepper pod extracts affected the macro- and micro-morphological features of the analysed filamentous fungal strains. Fungal strains belonging to the genera Alternaria, Aspergillus, Fusarium, Penicillium and Rhizopus produced mycelium with thinning, fragile and easily-break structure. In addition, their conidiophores became fragile presenting easily-break structures. Regarding other fungal genera (data not shown), the main alteration was the absence of conidiophore formation in some strains. The morphological changes observed in the filamentous fungi strains suggest the fungistatic potential of pepper pod extracts. Results suggest pepper pod extracts could not kill non/target fungal biodiversity but could control the growth and reproduction of some fungal plant pathogens. Inhibition of mycotoxin production is now under evaluation. Additional work is being developed in the field to validate the in vitro results.ANID (Agencia Nacional de Investigación y Desarrollo, Chile) through the ANID/FONDECYT/1221024 project. This work was partially funded by the Universidad de La Frontera (Chile). Authors thank the InES19-FRO19001 project, funded by the Ministerio de Educación (Chile) and executed by the Universidad de La Frontera. The authors thank Professor Ruben Carrillo (UFRO) for his support in confirming the pepper species and varieties identification.info:eu-repo/semantics/publishedVersio