TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Bystander suppression of collagen-induced arthritis in mice fed ovalbumin

We wanted to assess whether B-cell and/or T-cell responses to collagen and thereby the course of collagen-induced arthritis could be suppressed by regulatory mechanisms associated with oral tolerance to an unrelated protein. DBA/1 mice were fed ovalbumin (OVA)-containing pellets ad libitum for 1 week and subsequently coimmunized twice, with a mixture of bovine collagen type II (BCII) and OVA in Freund's complete adjuvant. Mice fed OVA before coimmunization with BCII and OVA had significantly lower arthritic scores than mice immunized with BCII only. Their body weight increased during the study period and their anti-BCII antibody activity was significantly IgG(2a )lower. The frequency of spleen cells producing IgG anti-BCII antibody was also reduced. Coimmunization per se slightly ameliorated the development of arthritis, resulting in an early, transient reduction. It resulted in significantly higher IgG(1 )anti-BCII antibody activity and increased splenocyte secretion of IFN-γ and IL-10 in response to BCII. Our findings demonstrate that OVA-specific regulatory events induced by feeding OVA, i.e. bystander suppression, reduced the severity of arthritis in animals immunized with BCII and OVA. Anti-BCII specific antibody responses and cytokine secretion by types 1 and 2 T helper cells were also decreased

Co-existing structures from high and low energy precipitation in fine scale aurora

High resolution multi-monochromatic measurements of auroral emissions have revealed the first optical evidence of coexisting small-scale auroral features resulting from separate high and low energy populations of precipitating electrons on the same field line. The features exhibit completely separate motion and morphology. From emission ratios and ion chemistry modeling, the average energy and energy flux of the precipitation is estimated. The high energy precipitation is found to form large pulsating patches of 0.1 Hz with a 3 Hz modulation, and non-pulsating co-existing discrete auroral filaments. The low energy precipitation is observed simultaneously on the same field line as discrete filaments with no pulsation. The simultaneous structures do not interact, and they drift with different speeds in different directions. We suggest that the high and low energy electron populations are accelerated by separate mechanisms, at different distances from earth. The small scale structures could be caused by local instabilities above the ionosphere

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM

Nursing assistants matters—An ethnographic study of knowledge sharing in interprofessional practice

© 2017 John Wiley & Sons Ltd Interprofessional collaboration involves some kind of knowledge sharing, which is essential and will be important in the future in regard to the opportunities and challenges in practices for delivering safe and effective health care. Nursing assistants are seldom mentioned as a group of health care workers that contribute to interprofessional collaboration in health care practice. The aim of this ethnographic study was to explore how the nursing assistants’ knowledge can be shared in a team on a spinal cord injury rehabilitation ward. Using a sociomaterial perspective on practice, we captured different aspects of interprofessional collaboration in health care. The findings reveal how knowledge was shared between professionals, depending on different kinds of practice architecture. These specific cultural–discursive, material–economic, and social–political arrangements enabled possibilities through which nursing assistants’ knowledge informed other practices, and others’ knowledge informed the practice of nursing assistants. By studying what health care professionals actually do and say in practice, we found that the nursing assistants could make a valuable contribution of knowledge to the team

Energy and flux variations across thin auroral arcs

Two discrete auroral arc filaments, with widths of less than 1 km, have been analysed using multi-station, multi-monochromatic optical observations from small and medium field-of-view imagers and the EISCAT radar. The energy and flux of the precipitating electrons, volume emission rates and local electric fields in the ionosphere have been determined at high temporal (up to 30 Hz) and spatial (down to tens of metres) resolution. A new time-dependent inversion model is used to derive energy spectra from EISCAT electron density profiles. The energy and flux are also derived independently from optical emissions combined with ion-chemistry modelling, and a good agreement is found. A robust method to obtain detailed 2-D maps of the average energy and number flux of small scale aurora is presented. The arcs are stretched in the north-south direction, and the lowest energies are found on the western, leading edges of the arcs. The large ionospheric electric fields (250 mV m?1) found from tristatic radar measurements are evidence of strong currents associated with the region close to the optical arcs. The different data sets indicate that the arcs appear on the boundaries between regions with different average energy of diffuse precipitation, caused by pitch-angle scattering. The two thin arcs on these boundaries are found to be related to an increase in number flux (and thus increased energy flux) without an increase in energ

Cardiovascular safety of growth hormone treatment in Noonan syndrome: real-world evidence

OBJECTIVE: To assess cardiovascular (CV) safety of growth hormone (GH) treatment in patients with Noonan syndrome (NS) in clinical practice. DESIGN: Two observational, multicentre studies (NordiNet® IOS and the ANSWER Program) evaluating long-term effectiveness and safety of GH in >38,000 paediatric patients, of which 421 had NS. METHODS: Serious adverse events, serious adverse reactions (SARs), and non-serious adverse reactions (NSARs) were reported by the treating physicians. CV comorbidities at baseline and throughout the studies were also recorded. RESULTS: The safety analysis set comprised 412 children with NS (29.1% females), with a mean (standard deviation) baseline age of 9.29 (3.88) years, treated with an average GH dose of 0.047 (0.014) mg/kg/day during childhood. CV comorbidities at baseline were reported in 48 (11.7%), most commonly pulmonary valve stenosis and atrial septal defects. Overall, 22 (5.3%) patients experienced 34 safety events. The most common were the NSARs: headache (eight events in seven patients) and arthralgia (five events in three patients). Two SARs occurred in one patient (brain neoplasm and metastases to spine). No CV safety events were recorded in patients with NS. Five CV comorbidities in five patients were reported after initiation of GH treatment: three cases of unspecified CV disease, one ruptured abdominal aortic aneurysm and one pulmonary valve stenosis. CONCLUSIONS: GH treatment had a favourable safety profile in patients with NS, including those with CV comorbidities. Prospective studies are warranted to systematically assess the safety of GH treatment in patients with Noonan syndrome and CV disease

A plasma telomeric cell-free DNA level in unaffected women with BRCA1 or/and BRCA2 mutations: a pilot study

Plasma cell-free DNA (cfDNA) is a small DNA fragment circulating in the bloodstream originating from both non-tumor- and tumor-derived cells. A previous study showed that a plasma telomeric cfDNA level decreases in sporadic breast cancer patients compared to controls. Tumor suppressor gene products including BRCA1 and BRCA2 (BRCA1&2) play an important role in telomere maintenance. In this study, we hypothesized that the plasma telomeric cfDNA level is associated with the mutation status of BRCA1&2 genes. To test this hypothesis, we performed plasma telomeric cfDNA quantitative PCR (qPCR)-based assays to compare 28 women carriers of the BRCA1&2 mutation with age-matched controls of 28 healthy women. The results showed that the plasma telomeric cfDNA level was lower in unaffected BRCA1&2 mutation carriers than in age-matched controls from non-obese women (BMI 30). Moreover, the plasma telomeric cfDNA level applied aptly to the Tyrer-Cuzick model in non-obese women. These findings suggest that circulating cfDNA may detect dysfunctional telomeres derived from cells with BRCA1&2 mutations and, therefore, its level is associated with breast cancer susceptibility. This pilot study warrants further investigation to elucidate the implication of plasma telomeric cfDNA levels in relation to cancer and obesity

Wind and Fisheries: Desktop Study on the Coexistence Between Offshore Wind and Fisheries in Sothern North Sea II

The Norwegian Government has launched a major initiative to promote offshore wind power , in which bottom-fixed wind power will be developed in the Southern North Sea II (SN II) area. There is a low level of fishing activities in this area with varying catch sizes over the years. The activities consist nearly exclusively of bottom trawling of sandeel. The fishing industry has raised concerns about the development of offshore wind farms (OWFs), including risks for collision and hindrance for fishing vessels, negative impacts on fish stocks, and other ecosystem-wide effects. This report has conducted a data study and compiled existing literature on these topics to, based on best available science, assess how OWF development could affect fisheries in SN II, the possibilities for facilitating coexistence for these two industries, and potential synergies. While the development of OWFs in SN II has the potential to bring both positive and negative effects on the fisheries as well as the marine life in the area, the findings suggest that coexistence between the two industries is possible. Potential impacts, including noise, magnetic fields, turbidity, artificial reef and FAD effects, and no-fishing zones, have not been shown to adversely affect populations of commercially important fish at OWF developments in the North Sea. With the ongoing technology shift to larger turbines, the space between each turbine is increasing, which may reduce collision risk. Seafloor cables can also be sufficiently buried to reduce the risk of damage by demersal trawls. Furthermore, most types of passive fishing gear (except for drifting nets) and practices are less problematic to use in an OWF. Should, though, the construction of OWFs in SN II cause restrictions on the fishery activities in the area, it is likely to cause increased fishing in other areas, often referred to in the scientific literature as the displacement effect, indicating that the economic loss will be smaller than the estimated catch values. Notable knowledge gaps are regarding positive and negative long term cumulative impacts and regional effects, impact on primary production and carbon assimilation from changed upper ocean mixing and impact from floating wind farms (not relevant in SN II). We emphasise the importance of early and ongoing input from relevant stakeholders to address concerns and find optimal mitigation measures for minimising the OWF footprint in SN II during the different phases of OWF development.Wind and Fisheries: Desktop Study on the Coexistence Between Offshore Wind and Fisheries in Sothern North Sea IIpublishedVersio