Transcriptional profiling of Aspergillus niger

The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipases. In contrast to polysaccharide-degrading enzyme networks, not much is known about the signaling and regulatory processes that control lipase expression and activity in fungi. This project was aimed to gain better understanding of lipid degradation mechanisms and how this process is regulated in A. niger, primarily via assessment of its gene transcription levels. Minimizing biological and technical variation is crucial for experiments in which transcription levels are determined, such as microarray and quantitative real-time PCR experiments. However, A. niger is difficult to cultivate in a reproducible way due to its filamentous growth. In addition, the complex processing steps of transcriptomics technologies add non-experimental variation to the biological variation. To reduce this data noise, robust protocols based on a batch-fermentation setup were developed. Variation in this setup was surveyed by examining the fungal transcriptional response towards a pulse of D-xylose. The sources of non-experimental variation were described by variance components analysis. Two-thirds of total variation stems from differences in routine handling of fermentations, but in absolute terms this variation is low. As D-xylose is an inducer of the xylanolytic system, the high reproducibility of cultures for the first time allowed a detailed description of the global fungal transcriptional response towards D-xylose using microarrays. The transcriptional response towards three plant derived oils was examined in another study. Both olive oil and a wheat-gluten extracted oil induce the transcription of genes involved in lipid metabolism and peroxisome assembly, albeit with different expression profiles. The third oil, a plant membrane lipid, did not trigger a transcriptional response. Microarray data are related to the physiology of the fungus. To better understand the general principles that underlie gene regulation and gene transcription, microarray data from cultures grown under mildly and strongly perturbed conditions were analyzed for co-expression of genes. Despite the diverse culturing conditions, co-expressed gene modules could be identified. Some of these modules can be related to biological functions. For some modules, conserved promoter elements were identified, which suggests that genes in these modules are regulated on a transcriptional level. The work described in this thesis shows that (i) high-quality -omics data for A. niger can be generated; that (ii) analysis and interpretation of these data enhances our understanding of the xylanolytic and lipid metabolic regulons; and (iii) that these data give insight into the regulatory mechanisms of this fungus. <br/

Efficient cloning system for construction of gene silencing vectors in Aspergillus niger

An approach based on Gateway recombination technology to efficiently construct silencing vectors was developed for use in the biotechnologically important fungus Aspergillus niger. The transcription activator of xylanolytic and cellulolytic genes XlnR of A. niger was chosen as target for gene silencing. Silencing was based on the expression vector pXLNRir that was constructed and used in co-transformation. From all the strains isolated (N = 77), nine showed poor xylan-degrading activities in two semi-quantitative plate assays testing different activities for xylan degradation. Upon induction on D-xylose, transcript levels of xlnR were decreased in the xlnR-silenced strains, compared to a wild-type background. Under these conditions, the transcript levels of xyrA and xynB (two genes regulated by XlnR) were also decreased for these xlnR-silenced strains. These results indicate that the newly developed system for rapid generation of silencing vectors is an effective tool for A. niger, and this can be used to generate strains with a tailored spectrum of enzyme activities or product formation by silencing specific genes encoding, e.g., regulators such as Xln

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

Continuous-flow IRMS technique for determining the 17O excess of CO2 using complete oxygen isotope exchange with cerium oxide

This paper presents an analytical system for analysis of all single substituted isotopologues (¹²C¹⁶O¹⁷O, ¹²C¹⁶O¹⁸O, ¹³C¹⁶O¹⁶O) in nanomolar quantities of CO₂ extracted from stratospheric air samples. CO₂ is separated from bulk air by gas chromatography and CO₂ isotope ratio measurements (ion masses 45 / 44 and 46 / 44) are performed using isotope ratio mass spectrometry (IRMS). The ¹⁷O excess (Δ¹⁷O) is derived from isotope measurements on two different CO₂ aliquots: unmodified CO₂ and CO₂ after complete oxygen isotope exchange with cerium oxide (CeO₂) at 700 °C. Thus, a single measurement of Δ¹⁷O requires two injections of 1 mL of air with a CO₂ mole fraction of 390 μmol mol⁻¹ at 293 K and 1 bar pressure (corresponding to 16 nmol CO₂ each). The required sample size (including flushing) is 2.7 mL of air. A single analysis (one pair of injections) takes 15 minutes. The analytical system is fully automated for unattended measurements over several days. The standard deviation of the ¹⁷O excess analysis is 1.7&permil;. Multiple measurements on an air sample reduce the measurement uncertainty, as expected for the statistical standard error. Thus, the uncertainty for a group of 10 measurements is 0.58&permil; for &Delta; ¹⁷O in 2.5 h of analysis. 100 repeat analyses of one air sample decrease the standard error to 0.20&permil;. The instrument performance was demonstrated by measuring CO₂ on stratospheric air samples obtained during the EU project RECONCILE with the high-altitude aircraft Geophysica. The precision for RECONCILE data is 0.03&permil; (1&sigma;) for δ¹³C, 0.07&permil; (1&sigma;) for δ¹⁸O and 0.55&permil; (1&sigma;) for &delta;¹⁷O for a sample of 10 measurements. This is sufficient to examine stratospheric enrichments, which at altitude 33 km go up to 12&permil; for &delta;¹⁷O and up to 8&permil; for δ¹⁸O with respect to tropospheric CO₂ : &delta;¹⁷O ~ 21&permil; Vienna Standard Mean Ocean Water (VSMOW), δ¹⁸O ~ 41&permil; VSMOW (Lämmerzahl et al., 2002). The samples measured with our analytical technique agree with available data for stratospheric CO₂

Trophic assimilation efficiency markedly increases at higher trophic levels in four-level host-parasitoid food chain

This is the final version of the article. Available from the Royal Society via the DOI in this record.Trophic assimilation efficiency (conversion of resource biomass into consumer biomass) is thought to be a limiting factor for food chain length in natural communities. In host-parasitoid systems, which account for the majority of terrestrial consumer interactions, a high trophic assimilation efficiency may be expected at higher trophic levels because of the close match of resource composition of host tissue and the consumer's resource requirements, which would allow for longer food chains. We measured efficiency of biomass transfer along an aphid-primary-secondary-tertiary parasitoid food chain and used stable isotope analysis to confirm trophic levels. We show high efficiency in biomass transfer along the food chain. From the third to the fourth trophic level, the proportion of host biomass transferred was 45%, 65% and 73%, respectively, for three secondary parasitoid species. For two parasitoid species that can act at the fourth and fifth trophic levels, we show markedly increased trophic assimilation efficiencies at the higher trophic level, which increased from 45 to 63% and 73 to 93%, respectively. In common with other food chains, δ(15)N increased with trophic level, with trophic discrimination factors (Δ(15)N) 1.34 and 1.49‰ from primary parasitoids to endoparasitic and ectoparasitic secondary parasitoids, respectively, and 0.78‰ from secondary to tertiary parasitoids. Owing to the extraordinarily high efficiency of hyperparasitoids, cryptic higher trophic levels may exist in host-parasitoid communities, which could alter our understanding of the dynamics and drivers of community structure of these important systems.The study was financially supported by the UK Natural Environment Research Council (LSMSF grant EK170-15/10) and by the Natural Environment Research Council (NERC grant no. NE/K005650/1) to F.J.F.v.V

Low levels of artificial light at night strengthen top-down control in insect food web

This is the author accepted manuscript. The final version is available from Elsevier via the DOI in this record.Artificial light has transformed the nighttime environment of large areas of the earth, with 88% of Europe and almost 50% of the United States experiencing light-polluted night skies [1]. The consequences for ecosystems range from exposure to high light intensities in the vicinity of direct light sources to the very widespread but lower lighting levels further away [2]. While it is known that species exhibit a range of physiological and behavioural responses to artificial nighttime lighting [e.g., 3, 4, 5], there is a need to gain a mechanistic understanding of whole ecological community impacts [6, 7], especially to different light intensities. Using a mesocosm field experiment with insect communities, we determined the impact of intensities of artificial light ranging from 0.1 to 100 lux on different trophic levels and interactions between species. Strikingly, we found the strongest impact at low levels of artificial lighting (0.1 to 5 lux), which led to a 1.8 times overall reduction in aphid densities. Mechanistically, artificial light at night increased the efficiency of parasitoid wasps in attacking aphids, with twice the parasitism rate under low light levels compared to unlit controls. However at higher light levels, parasitoid wasps spent longer away from the aphid host plants, diminishing this increased efficiency. Therefore aphids reached higher densities under increased light intensity as compared to low levels of lighting where they were limited by higher parasitoid efficiency. Our study highlights the importance of different intensities of artificial light in driving the strength of species interactions and ecosystem functions.The research leading to this paper was funded from NERC grant NE/N001672/1

Revealing charge-tunneling processes between a quantum dot and a superconducting island through gate sensing

We report direct detection of charge-tunneling between a quantum dot and a superconducting island through radio-frequency gate sensing. We are able to resolve spin-dependent quasiparticle tunneling as well as two-particle tunneling involving Cooper pairs. The quantum dot can act as an RF-only sensor to characterize the superconductor addition spectrum, enabling us to access subgap states without transport. Our results provide guidance for future dispersive parity measurements of Majorana modes, which can be realized by detecting the parity-dependent tunneling between dots and islands.Comment: 6 pages, 4 figures, supplemental material included as ancillary fil