47 research outputs found
Cellular uptake of steroids
The general concept concerning mechanism of steroid
hormone action includes several steps at the molecular level
about which very little is known. ·For several steroid responsive
tissues it has been shown, that the steroid molecule
after entering its target cell, becomes immediately bound by
a "cytoplasmic receptor" which transfers the steroid into the
nucleus. This translocation step is temperature dependent.
Simultaneously the receptor part of the complex is transformed
into a smaller subunit, the "nuclear receptor". In the
nucleus the steroid receptor complex becomes attached to an
acidic non histone protein, the "nuclear acceptor" site, and
provokes an increase in RNA polymerase activity resulting in
new RNA synthesis followed by increased protein synthesis
Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line
During sex differentiation, androgens are essential for development of the
male genital tract. The Wolffian duct is an androgen-sensitive target
tissue that develops into the epididymis, vas deferens, and seminal
vesicle. The present study aimed to identify androgen-regulated proteins
that are involved in development of Wolffian duct-derived structures. We
have used male mouse embryos transgenic for temperature-sensitive simian
virus 40 large tumor antigen at 18 d of gestation, to generate
immortalized mouse fetal vas deferens (MFVD) parental and clonal cell
lines. The MFVD parental and clonal cell lines express androgen receptor
protein and show features of Wolffian duct mesenchymal cells. Clonal cell
line MFVD A6 was selected for proteomic analysis and cultured in the
absence or presence of androgens. Subsequently, two-dimensional gel
electrophoresis was performed on total cell lysates. Differentially
expressed proteins were analyzed by matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry and two
androgen-regulated proteins were identified as mElfin and CArG-binding
factor-A (CBF-A). CBF-A and mElfin are known to bind to cytoskeletal
F-actin. Both proteins appeared to be regulated by androgens at the
posttranslational level, possibly involving phosphorylation.
Posttranslational modification of mElfin and CBF-A by androgens may be
associated with a cytoskeletal change that is involved in
androgen-regulated gene expression
Androgen receptor expression in human ovarian and uterine tissue of long term androgen-treated transsexual women
Androgen receptor (AR) modulation in human uteri and ovaries of long term androgen-treated transsexual female patients was investigated. Androgen receptor expression was evaluated immunohistochemically in the ovaries of 11 and the endometria and myometria of six androgen-treated transsexual female patients. This was compared with AR expression in the ovaries and uteri of premenopausal and postmenopausal women not receiving treatment and in 10 ovaries of female patients with polycystic ovarian disease (PCOD). In the normal ovaries germinal epithelium, granulosa cells of antral follicles, corpus luteum, and thecal and stromal cells exhibited moderate AR expression. The more intense and uniform staining of ovarian stroma of female transsexual patients and those of patients with PCOD compared with ovarian stroma of normal controls was most remarkable. This similarity in histology and distribution of ARs supports the hypothesis that PCOD is an androgen-mediated disorder. Immunostaining for ARs was only occasionally detectable in the uteri of premenopausal and postmenopausal women. In contrast, myometrial and endometrial stroma of the uteri of female transsexual patients displayed an intense and diffuse nuclear immunostaining, but glandular epithelia remained unstained. Western blot analysis of the ovaries and uterine myometrial tissue samples from transsexual female patients confirmed the presence of the 110-kd AR molecule. Because the androgen treatment of some transsexual female patients was discontinued 6 weeks before they underwent hysterosalpingo-oophorectomy, our data indicate a stable and persistent androgen-induced up-regulation of AR expression in ovaries
Hormonal control of gubernaculum development during testis descent: gubernaculum outgrowth in vitro requires both insulin-like factor and androgen
The gubernaculum connects the gonad to the inguinoscrotal region and is
involved in testis descent. It rapidly develops in the male fetus, whereas
development in the female fetus is lacking. Possible factors involved in
gubernaculum development are androgens, anti-Mullerian hormone (AMH), and
insulin-like factor (Insl3). Sexual dimorphism in gubernaculum development
correlated with the mitotic activity of cells in the gubernacular bulbs
from male and female fetuses. Androgen receptor expression was restricted
to the mesenchymal core of the gubernacular bulb, whereas skeletal muscle
was detected in its outer layer. In an organ culture system devised to
further study gubernaculum development in vitro, morphology of
gubernacular explants grown in the presence of testes was comparable with
that of gubernacula developed in vivo. Testicular tissue or medium
containing R1881, a synthetic androgen, had a growth stimulatory effect on
gubernacular explants compared with ovarian tissue or basal medium only.
Moreover, Amh-/-, Amh+/-, and Insl3+/- testes stimulated the growth of
gubernacular explants to the same extent as control testes. Insl3-/-
testes, however, did not produce such an activity. This study reveals an
essential role for both androgen and Insl3 in the gubernaculum outgrowth
during transabdominal testis descent
Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2)
Previous studies in yeast and mammalian cells showed a functional
interaction between the amino-terminal domain and the carboxy-terminal,
ligand-binding domain (LBD) of the human androgen receptor (AR). In the
present study, the AR subdomains involved in this in vivo interaction were
determined in more detail. Cotransfection experiments in Chinese hamster
ovary (CHO) cells and two-hybrid experiments in yeast revealed that two
regions in the NH2-terminal domain are involved in the functional
interaction with the LBD: an interacting domain at the very NH2 terminus,
located between amino acid residues 3 and 36, and a second domain,
essential for transactivation, located between residues 370 and 494.
Substitution of glutamic acid by glutamine at position 888 (E888Q) in the
AF-2 activation domain (AD) core region in the LBD, markedly decreased the
interaction with the NH2-terminal domain. This mutation neither influenced
hormone binding nor LBD homodimerization, suggesting a role of the AF-2 AD
core region in the functional interaction between the NH2-terminal domain
and the LBD. The AF-2 AD core region was also involved in the interaction
with the coactivator TIF2 (transcriptional intermediary factor 2), as the
E888Q mutation decreased the stimulatory effect of TIF2 on AR AF-2
activity. Cotransfection of TIF2 and the AR NH2-terminal domain expression
vectors did not result in synergy between both factors in the induction of
AR AF-2 activity. TIF2 highly induced AR AF-2 activity on a complex
promoter [mouse mammary tumor virus (MMTV)], but it was hardly active on a
minimal promoter (GRE-TATA). In contrast, the AR NH2-terminal domain
induced AR AF-2 activity on both promoter constructs. These data indicate
that both the AR NH2-terminal domain and the coactivator TIF2 functionally
interact, either directly or indirectly, with the AF-2 AD core region in
the AR-LBD, but the level of transcriptional response induced by TIF2
depends on the promoter context
Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor
We studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and transfected into mammalian cells. Western blot showed a smaller androgen receptor of 94 kDa for the transfected mutated cDNA instead of 110 kDa. Androgen-binding assay of the mutated transfected cells assessed the lack of androgen-binding. Gel retardation assay demonstrated the ability of the mutant to bind target DNA; however, the mutant was unable to transactivate a reporter gene. Although the role of the partial deletion in the lack of androgen action was expected, in vitro analyses highlight the role of the abnormal C-terminal portion in the inhibition of the receptor transregulatory activity of the protein causing androgen resistance in this family
Substitution of Ala564 in the first zinc cluster of the deoxyribonucleic acid (DNA)-binding domain of the androgen receptor by Asp, Asn, or Leu exerts differential effects on DNA binding
In the androgen receptor of a patient with androgen insensitivity, the
alanine residue at position 564 in the first zinc cluster of the
DNA-binding domain was substituted by aspartic acid. In other members of
the steroid receptor family, either valine or alanine is present at the
corresponding position, suggesting the importance of a neutral amino acid
residue at this site. The mutant receptor was transcriptionally inactive,
which corresponded to the absence of specific DNA binding in gel
retardation assays, and its inactivity in a promoter interference assay.
Two other receptor mutants with a mutation at this same position were
created to study the role of position 564 in the human androgen receptor
on DNA binding in more detail. Introduction of asparagine at position 564
resulted in transcription activation of a mouse mammary tumor virus
promoter, although at a lower level compared with the wild-type receptor.
Transcription activation of an (ARE)2-TATA promoter was low, and binding
to different hormone response elements could not be visualized. The
receptor with a leucine residue at position 564 was as active as the
wild-type receptor on a mouse mammary tumor virus promoter and an
(ARE)2-TATA promoter, but interacted differentially with several hormone
response elements in a gel retardation assay. The results of the
transcription activation and DNA binding studies could partially be
predicted from three-dimensional modeling data. The phenotype of the
patient was explained by the negative charge, introduced at position 564
Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter
Transcription of the prostate-specific antigen (PSA) gene is androgen
regulated. The PSA promoter contains at position -170 the sequence
AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response
element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high
affinity androgen receptor (AR) binding site and acts as a functional ARE
in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR:
androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates
with the ARE in androgen induction of the PSA promoter. A construct with
three ARR copies linked to a minimal PSA promoter showed a strong
(104-fold) androgen induced activity. The ARR was also able to confer
androgen responsiveness to a minimal thymidine kinase promoter. Both AR
binding and transcriptional activity resided in a 20-base pair ARR
subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that
the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active,
low affinity AR binding site. Like AR, the glucocorticoid receptor was
able to stimulate PSA promoter activity. Both the ARE and ARR are involved
in dexamethasone regulation of the PSA promoter. Both the AR and
glucocorticoid receptor were 20-100-fold more active on ARR-PSA and
ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell
types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell
specificity
Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells
Androgen receptor-positive LNCaP cells were stably transfected with a rat
glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in
the generated cell lines revealed high-affinity binding of the cognate
ligands to their receptors. Transfection experiments with the newly
derived cell lines showed that, like androgen receptor, GR can induce
activity of a prostate-specific antigen promoter fragment linked to the
luciferase gene. Similarly, dexamethasone can stimulate expression of
endogenous prostate-specific antigen messenger RNA. Cell proliferation
could be induced by R1881. In contrast, dexamethasone treatment of the
GR-positive sublines had no stimulatory effect on cell growth. Using the
differential display technique, a so far unknown complementary DNA
fragment, designated 21.1, specifically induced by androgens and not by
glucocorticoids, has been identified. In conclusion, the newly generated
cell lines, together with the parental LNCaP cell line, form an attractive
system with which to study the mechanism of specificity of steroid hormone
regulation of gene expression
Phenotypic variation in a family with partial androgen insensitivity syndrome explained by differences in 5alpha dihydrotestosterone availability
Mutations in the androgen receptor (AR) gene result in a wide range of
phenotypes of the androgen insensitivity syndrome (AIS). Inter- and
intrafamilial differences in the phenotypic expression of identical AR
mutations are known, suggesting modifying factors in establishing the
phenotype. Two 46,XY siblings with partial AIS sharing the same AR gene
mutation, R846H, but showing very different phenotypes are studied. Their
parents are first cousins. One sibling with grade 5 AIS was raised as a
girl; the other sibling with grade 3 AIS was raised as a boy. In both
siblings serum levels of hormones were measured; a sex hormone-binding
globulin (SHBG) suppression test was completed; and mutation analysis of
the AR gene, Scatchard, and SDS-PAGE analysis of the AR protein was
performed. Furthermore, 5alpha-reductase 2 expression and activity in
genital skin fibroblasts were investigated, and the 5alpha-reductase 2
gene was sequenced. The decrease in SHBG serum levels in a SHBG
suppression test did not suggest differences in androgen sensitivity as
the cause of the phenotypic variation. Also, androgen binding
characteristics of the AR, AR expression levels, and the phosphorylation
pattern of the AR on hormone binding were identical in both siblings.
However, 5alpha-reductase 2 activity was normal in genital skin
fibroblasts from the phenotypic male patient but undetectable in genital
skin fibroblasts from the phenotypic female patient. The lack of
5alpha-reductase 2 activity was due to absent or reduced expression of
5alpha-reductase 2 in genital skin fibroblasts from the phenotypic female
patient. Exon and flanking intron sequences of the 5alpha-reductase 2 gene
showed no mutations in either siblin