Cellular uptake of steroids

The general concept concerning mechanism of steroid hormone action includes several steps at the molecular level about which very little is known. ·For several steroid responsive tissues it has been shown, that the steroid molecule after entering its target cell, becomes immediately bound by a "cytoplasmic receptor" which transfers the steroid into the nucleus. This translocation step is temperature dependent. Simultaneously the receptor part of the complex is transformed into a smaller subunit, the "nuclear receptor". In the nucleus the steroid receptor complex becomes attached to an acidic non histone protein, the "nuclear acceptor" site, and provokes an increase in RNA polymerase activity resulting in new RNA synthesis followed by increased protein synthesis

Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line

During sex differentiation, androgens are essential for development of the male genital tract. The Wolffian duct is an androgen-sensitive target tissue that develops into the epididymis, vas deferens, and seminal vesicle. The present study aimed to identify androgen-regulated proteins that are involved in development of Wolffian duct-derived structures. We have used male mouse embryos transgenic for temperature-sensitive simian virus 40 large tumor antigen at 18 d of gestation, to generate immortalized mouse fetal vas deferens (MFVD) parental and clonal cell lines. The MFVD parental and clonal cell lines express androgen receptor protein and show features of Wolffian duct mesenchymal cells. Clonal cell line MFVD A6 was selected for proteomic analysis and cultured in the absence or presence of androgens. Subsequently, two-dimensional gel electrophoresis was performed on total cell lysates. Differentially expressed proteins were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and two androgen-regulated proteins were identified as mElfin and CArG-binding factor-A (CBF-A). CBF-A and mElfin are known to bind to cytoskeletal F-actin. Both proteins appeared to be regulated by androgens at the posttranslational level, possibly involving phosphorylation. Posttranslational modification of mElfin and CBF-A by androgens may be associated with a cytoskeletal change that is involved in androgen-regulated gene expression

Androgen receptor expression in human ovarian and uterine tissue of long term androgen-treated transsexual women

Androgen receptor (AR) modulation in human uteri and ovaries of long term androgen-treated transsexual female patients was investigated. Androgen receptor expression was evaluated immunohistochemically in the ovaries of 11 and the endometria and myometria of six androgen-treated transsexual female patients. This was compared with AR expression in the ovaries and uteri of premenopausal and postmenopausal women not receiving treatment and in 10 ovaries of female patients with polycystic ovarian disease (PCOD). In the normal ovaries germinal epithelium, granulosa cells of antral follicles, corpus luteum, and thecal and stromal cells exhibited moderate AR expression. The more intense and uniform staining of ovarian stroma of female transsexual patients and those of patients with PCOD compared with ovarian stroma of normal controls was most remarkable. This similarity in histology and distribution of ARs supports the hypothesis that PCOD is an androgen-mediated disorder. Immunostaining for ARs was only occasionally detectable in the uteri of premenopausal and postmenopausal women. In contrast, myometrial and endometrial stroma of the uteri of female transsexual patients displayed an intense and diffuse nuclear immunostaining, but glandular epithelia remained unstained. Western blot analysis of the ovaries and uterine myometrial tissue samples from transsexual female patients confirmed the presence of the 110-kd AR molecule. Because the androgen treatment of some transsexual female patients was discontinued 6 weeks before they underwent hysterosalpingo-oophorectomy, our data indicate a stable and persistent androgen-induced up-regulation of AR expression in ovaries

Hormonal control of gubernaculum development during testis descent: gubernaculum outgrowth in vitro requires both insulin-like factor and androgen

The gubernaculum connects the gonad to the inguinoscrotal region and is involved in testis descent. It rapidly develops in the male fetus, whereas development in the female fetus is lacking. Possible factors involved in gubernaculum development are androgens, anti-Mullerian hormone (AMH), and insulin-like factor (Insl3). Sexual dimorphism in gubernaculum development correlated with the mitotic activity of cells in the gubernacular bulbs from male and female fetuses. Androgen receptor expression was restricted to the mesenchymal core of the gubernacular bulb, whereas skeletal muscle was detected in its outer layer. In an organ culture system devised to further study gubernaculum development in vitro, morphology of gubernacular explants grown in the presence of testes was comparable with that of gubernacula developed in vivo. Testicular tissue or medium containing R1881, a synthetic androgen, had a growth stimulatory effect on gubernacular explants compared with ovarian tissue or basal medium only. Moreover, Amh-/-, Amh+/-, and Insl3+/- testes stimulated the growth of gubernacular explants to the same extent as control testes. Insl3-/- testes, however, did not produce such an activity. This study reveals an essential role for both androgen and Insl3 in the gubernaculum outgrowth during transabdominal testis descent

Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2)

Previous studies in yeast and mammalian cells showed a functional interaction between the amino-terminal domain and the carboxy-terminal, ligand-binding domain (LBD) of the human androgen receptor (AR). In the present study, the AR subdomains involved in this in vivo interaction were determined in more detail. Cotransfection experiments in Chinese hamster ovary (CHO) cells and two-hybrid experiments in yeast revealed that two regions in the NH2-terminal domain are involved in the functional interaction with the LBD: an interacting domain at the very NH2 terminus, located between amino acid residues 3 and 36, and a second domain, essential for transactivation, located between residues 370 and 494. Substitution of glutamic acid by glutamine at position 888 (E888Q) in the AF-2 activation domain (AD) core region in the LBD, markedly decreased the interaction with the NH2-terminal domain. This mutation neither influenced hormone binding nor LBD homodimerization, suggesting a role of the AF-2 AD core region in the functional interaction between the NH2-terminal domain and the LBD. The AF-2 AD core region was also involved in the interaction with the coactivator TIF2 (transcriptional intermediary factor 2), as the E888Q mutation decreased the stimulatory effect of TIF2 on AR AF-2 activity. Cotransfection of TIF2 and the AR NH2-terminal domain expression vectors did not result in synergy between both factors in the induction of AR AF-2 activity. TIF2 highly induced AR AF-2 activity on a complex promoter [mouse mammary tumor virus (MMTV)], but it was hardly active on a minimal promoter (GRE-TATA). In contrast, the AR NH2-terminal domain induced AR AF-2 activity on both promoter constructs. These data indicate that both the AR NH2-terminal domain and the coactivator TIF2 functionally interact, either directly or indirectly, with the AF-2 AD core region in the AR-LBD, but the level of transcriptional response induced by TIF2 depends on the promoter context

Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

We studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and transfected into mammalian cells. Western blot showed a smaller androgen receptor of 94 kDa for the transfected mutated cDNA instead of 110 kDa. Androgen-binding assay of the mutated transfected cells assessed the lack of androgen-binding. Gel retardation assay demonstrated the ability of the mutant to bind target DNA; however, the mutant was unable to transactivate a reporter gene. Although the role of the partial deletion in the lack of androgen action was expected, in vitro analyses highlight the role of the abnormal C-terminal portion in the inhibition of the receptor transregulatory activity of the protein causing androgen resistance in this family

Substitution of Ala564 in the first zinc cluster of the deoxyribonucleic acid (DNA)-binding domain of the androgen receptor by Asp, Asn, or Leu exerts differential effects on DNA binding

In the androgen receptor of a patient with androgen insensitivity, the alanine residue at position 564 in the first zinc cluster of the DNA-binding domain was substituted by aspartic acid. In other members of the steroid receptor family, either valine or alanine is present at the corresponding position, suggesting the importance of a neutral amino acid residue at this site. The mutant receptor was transcriptionally inactive, which corresponded to the absence of specific DNA binding in gel retardation assays, and its inactivity in a promoter interference assay. Two other receptor mutants with a mutation at this same position were created to study the role of position 564 in the human androgen receptor on DNA binding in more detail. Introduction of asparagine at position 564 resulted in transcription activation of a mouse mammary tumor virus promoter, although at a lower level compared with the wild-type receptor. Transcription activation of an (ARE)2-TATA promoter was low, and binding to different hormone response elements could not be visualized. The receptor with a leucine residue at position 564 was as active as the wild-type receptor on a mouse mammary tumor virus promoter and an (ARE)2-TATA promoter, but interacted differentially with several hormone response elements in a gel retardation assay. The results of the transcription activation and DNA binding studies could partially be predicted from three-dimensional modeling data. The phenotype of the patient was explained by the negative charge, introduced at position 564

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression

Phenotypic variation in a family with partial androgen insensitivity syndrome explained by differences in 5alpha dihydrotestosterone availability

Mutations in the androgen receptor (AR) gene result in a wide range of phenotypes of the androgen insensitivity syndrome (AIS). Inter- and intrafamilial differences in the phenotypic expression of identical AR mutations are known, suggesting modifying factors in establishing the phenotype. Two 46,XY siblings with partial AIS sharing the same AR gene mutation, R846H, but showing very different phenotypes are studied. Their parents are first cousins. One sibling with grade 5 AIS was raised as a girl; the other sibling with grade 3 AIS was raised as a boy. In both siblings serum levels of hormones were measured; a sex hormone-binding globulin (SHBG) suppression test was completed; and mutation analysis of the AR gene, Scatchard, and SDS-PAGE analysis of the AR protein was performed. Furthermore, 5alpha-reductase 2 expression and activity in genital skin fibroblasts were investigated, and the 5alpha-reductase 2 gene was sequenced. The decrease in SHBG serum levels in a SHBG suppression test did not suggest differences in androgen sensitivity as the cause of the phenotypic variation. Also, androgen binding characteristics of the AR, AR expression levels, and the phosphorylation pattern of the AR on hormone binding were identical in both siblings. However, 5alpha-reductase 2 activity was normal in genital skin fibroblasts from the phenotypic male patient but undetectable in genital skin fibroblasts from the phenotypic female patient. The lack of 5alpha-reductase 2 activity was due to absent or reduced expression of 5alpha-reductase 2 in genital skin fibroblasts from the phenotypic female patient. Exon and flanking intron sequences of the 5alpha-reductase 2 gene showed no mutations in either siblin