Going in Reverse to Go Forward: Institutional Repositories and The New York Public Library

The Research Libraries of the New York Public Library is one of the most significant public information centers in the world. Since the opening in 1911 of its flagship building at Fifth Avenue and 42nd Street in the heart of Manhattan , the Library has aimed to serve people from all walks of life and on a global scale. ..

Promotion of healthy nutrition in clinical practice: a cross-sectional survey of practices and barriers among physiotherapists in southeast Nigeria

AbstractBackgroundHealthy diet counselling is an important concept in health promotion. Physiotherapists are well positioned to initiate or support healthy nutrition in addition to physical activity counselling, in routine patient consultation.ObjectiveTo determine the practices about and barriers to diet counselling practices among physiotherapists in Southeast Nigeria.MethodsIn this cross-sectional survey, a total of 140 questionnaires were distributed among physiotherapists.ResultsOverall, 103 physiotherapists responded. Physiotherapists are confident and consider the incorporation of dietary counselling very important and of high priority in their daily clinical work. They, however, assessed and counselled on dietary status opportunistically in patients. Notwithstanding, physiotherapists believed that the diet counselling they give could be effective in helping patients change their unhealthy dieting practices. Patients were also amenable to physiotherapists advocating on diet issues as part of their consultation. Several barriers to incorporating diet counselling into physiotherapy practice were identified, including lack of access to a dietician/health promotion staff/counsellors, lack of proper patient education materials, lack of expertise in relation to dietary risk factors' assessment and management, and uncertainty about what dietary services to provide.ConclusionAlthough physiotherapists consider it important to incorporate diet counselling in their daily clinical practice, development and implementation of strategies to improve physiotherapists' diet counselling knowledge, competence, skills, and practice are warranted

Human evolution in Siberia: from frozen bodies to ancient DNA

<p>Abstract</p> <p>Background</p> <p>The Yakuts contrast strikingly with other populations from Siberia due to their cattle- and horse-breeding economy as well as their Turkic language. On the basis of ethnological and linguistic criteria as well as population genetic studies, it has been assumed that they originated from South Siberian populations. However, many questions regarding the origins of this intriguing population still need to be clarified (e.g. the precise origin of paternal lineages and the admixture rate with indigenous populations). This study attempts to better understand the origins of the Yakuts by performing genetic analyses on 58 mummified frozen bodies dated from the 15^thto the 19^thcentury, excavated from Yakutia (Eastern Siberia).</p> <p>Results</p> <p>High quality data were obtained for the autosomal STRs, Y-chromosomal STRs and SNPs and mtDNA due to exceptional sample preservation. A comparison with the same markers on seven museum specimens excavated 3 to 15 years ago showed significant differences in DNA quantity and quality. Direct access to ancient genetic data from these molecular markers combined with the archaeological evidence, demographical studies and comparisons with 166 contemporary individuals from the same location as the frozen bodies helped us to clarify the microevolution of this intriguing population.</p> <p>Conclusion</p> <p>We were able to trace the origins of the male lineages to a small group of horse-riders from the Cis-Baïkal area. Furthermore, mtDNA data showed that intermarriages between the first settlers with Evenks women led to the establishment of genetic characteristics during the 15^thcentury that are still observed today.</p

Is (poly-) substance use associated with impaired inhibitory control? A mega-analysis controlling for confounders.

Many studies have reported that heavy substance use is associated with impaired response inhibition. Studies typically focused on associations with a single substance, while polysubstance use is common. Further, most studies compared heavy users with light/non-users, though substance use occurs along a continuum. The current mega-analysis accounted for these issues by aggregating individual data from 43 studies (3610 adult participants) that used the Go/No-Go (GNG) or Stop-signal task (SST) to assess inhibition among mostly "recreational" substance users (i.e., the rate of substance use disorders was low). Main and interaction effects of substance use, demographics, and task-characteristics were entered in a linear mixed model. Contrary to many studies and reviews in the field, we found that only lifetime cannabis use was associated with impaired response inhibition in the SST. An interaction effect was also observed: the relationship between tobacco use and response inhibition (in the SST) differed between cannabis users and non-users, with a negative association between tobacco use and inhibition in the cannabis non-users. In addition, participants' age, education level, and some task characteristics influenced inhibition outcomes. Overall, we found limited support for impaired inhibition among substance users when controlling for demographics and task-characteristics

Les erreurs de langue et de formulation à l’écrit dans l’apprentissage du français en classe de seconde

Professorat des lycées et collègesCe mémoire part d’une constatation simple : en classe de seconde, de nombreux élèves, quel que soit leur niveau, éprouvent des difficultés lorsqu’ils sont confrontés à des activités d’écriture. Ces difficultés se traduisent essentiellement par des erreurs de langue (c’est-à-dire d’orthographe et de grammaire) et de formulation. Partant de ce constat, nous avons tenté ici d’établir une typologie des erreurs de langue et de formulation avant de proposer des remédiations axées d’une part sur l’autocorrection et d’autre part sur des activités d’écriture et/ou de réécriture obligeant l’élève à un questionnement permanent sur la spécificité et l’articulation du langage écrit. Confronté au risque d’un " cloisonnement horaire ", nous avons essayé, lors de chaque séquence, de dépasser le cadre trop rigide de l’aide individualisée ou du module, pour mettre en place, avec l’ensemble des élèves, y compris lors des cours communs, une réflexion utile sur l’apprentissage de l’écriture

The Brd gene family and the N pathway

Genomic DNA mapping Bob and Tom probes were hybridized successively to a filter array of Drosophila P1 genomic DNA clones (Genome Systems). The positive clones were found to be part of an overlapping set in the 71A1-2 region of the left arm of chromosome 3 (BDGP), the known cytological location of Brd Plasmid construction To create Brd family gene expression constructs, we used PCR to amplify the coding regions and 8-10 nt of 5′ UTR sequence (to provide translational initiation context) of Brd, E(spl)m4, Bob, Tom and E(spl)mα. PCR products containing upstream BamHI and downstream SalI sites were subcloned into pBluescript and fully sequenced. These fragments were then excised with BamHI and XhoI and cloned into the BglII and XhoI sites of the pUAST vector Germline transformation P element-mediated germline transformation was carried out as described by E. C. Lai and others 293 The Brd gene family and the N pathway DNA-binding assays GST-Su(H) fusion protein was purified as described by RNA duplex assays Wild-type (PB wt) and mutant (PB mut) proneural box-containing RNA probes derived from the ato 3′ UTR were constructed as follows. The following pairs of oligonucleotides were synthesized, annealed, filled in with Klenow fragment, and cloned into the EcoRV site of pBS+: PB wt: CCTAGCCTAAATGGAAGACAATGATTAAGACTAAGGAAGACAATGTAAAAGCACC ATCGGATTTACCTTCTGTTACTAATTCTGATTCCTTCTGTTACATTTTCGTGGGG PB mut

The E-Coach transition support computer telephony implementation study: Protocol of a randomized trial

BACKGROUND: Patients requiring complex care are at high risk during the transition from one setting of care to another. Effective interventions to support care transitions have been designed but are very resource intensive. Telemonitoring has been considered as an approach to enhance care transition support, but many telemonitoring systems require special equipment or web-based interfaces to interact with patients and caregivers. METHODS/DESIGN: In this paper we report our protocol for developing and testing E-Coach, an interactive voice response (IVR)-enhanced care transition intervention that monitors patients at home using their personal phone. The elements described include 1) development of an IVR monitoring system that will be based on Coleman\u27s four pillars of care transition support; 2) development of a web-based dashboard of IVR responses that alert care transition nurses (CTN) of patient/caregiver concerns after discharge and allow documentation by the CTN when patients/caregivers are called; 3) pilot testing of the IVR system by patients and providers with refinement of the system based on patient/provider input; and 4) a pragmatic protocol for formal testing through a randomized controlled trial (RCT) of the E-Coach intervention in congestive heart failure (CHF) and chronic obstructive pulmonary disease (COPD) patients admitted to a large tertiary hospital. Trial Registration: CT.gov#: NCT01135381