Synthesis, characterization, structural, redox and electrocatalytic proton reduction properties of cobalt polypyridyl complexes

A monoanionic amido pentadentate ligand bpaqH (2-(bis(pyridin-2-ylmethyl)amino)-N-(quinolin-8-yl)acetamide) and its corresponding cobalt(III) chloro complex [Co(bpaq)Cl]Cl: 1 and aqua derivative [Co(bpaq)(OH2)](ClO4)2: 2 were successfully synthesized and fully characterized by different analytical and spectroscopic techniques such as FT-IR, 1H NMR, UV–vis spectroscopy, ESI mass spectra. The structures of 1 and 2 have been determined by the single-crystal X-ray diffraction. Spectral and redox properties were investigated along with free ligand under electrochemical conditions. Both complexes performed proton reduction activity under soluble, diffusion-limited conditions in acetonitrile with acetic acid as an external proton source with overpotentials of 0.412 V for 1 and 0.394 V for 2. The stability of the catalysts was inspected by the time-dependent UV–vis spectroscopy; 1 and 2 were found to be highly stable in the absence and presence of acetic acid. There was no significant spectral change before and after the controlled potential electrolysis suggesting no change in molecular integrity during electrocatalysis

Formation, Reactivity, Photorelease, and Scavenging of NO in Ruthenium Nitrosyl Complexes

The two newly designed nitrosyl complexes with Enemark–Feltham notation {RuNO}6 and {RuNO}7 configurations have been isolated as the perchlorate salts in the molecular framework [RuII(dmdptz)(phen)(NO)]n+ (dmdptz: N,N-dimethyl-4,6-di(pyridin-2-yl)-1,3,5-triazin-2-amine and phen: 1,10-phenanthroline) [RuII(dmdptz)(phen)(NO+)](ClO4)3 [4](ClO4)3 and [RuII(dmdptz)(phen)(NO•)](ClO4)2 [5](ClO4)2 respectively. The single crystal X-ray structures of complexes [RuII(dmdptz)(phen)Cl](ClO4) [1](ClO4), [RuII(dmdptz)(phen)(NO2)](ClO4) [3](ClO4) and [4](ClO4)3 have been determined. The π– acceptance of the NO+ moiety in [4](ClO4)3 is reflected from the triple bond characteristic bond length 1.131(5) Å with simultaneous trans angle of 175.3(4)° as a proof of true linear coordination mode. A sizable shift in ν (NO) frequency (Δν = 361cm−1) on moving from [4](ClO4)3 to [5](ClO4)2 are in good agreement for largely NO centered reduction with the changes in bonding {RuNO}6 [4](ClO4)3 to {RuNO}7 [5](ClO4)2. The redox properties of [4](ClO4)3 along with the precursor complexes, have been investigated. On exposure to visible light in the deoxygenated acetonitrile solution at room temperature both [4](ClO4)3 and [5](ClO4)2 spontaneously transform to their corresponding solvated derivative [RuII(dmdptz)(phen)(CH3CN)](ClO4)2 [2](ClO4)2 via the facile photocleavage of Ru–NO bond with KNO 9.26 x 10–3 min–1 (t1/2 = 74 min) and 4.03 x 10–2 min–1 (t1/2 = 17 min) respectively. The photoreleased “NO” can be scavenged by biologically relevant target molecule myoglobin as an Mb–NO adduct

High phenoxazinone synthase activity of two mononuclear cis-dichloro cobalt(ii) complexes with a rigid pyridyl scaffold

Phenoxazinone synthase (PHS) is a pentanuclear copper enzyme studied for the last two decades, and though both manganese and copper complexes have been explored extensively, there are only a handful of reports on cobalt mononuclear moieties. In this regard, we have successfully synthesized two cis dichloro cobalt(ii) mononuclear complexes Co(bpy)2Cl2:[1] and Co(L1)2Cl2:[2] with polypyridyl ligands (where bpy = 2,2′-bipyridine, L1 = 2,2′-(1-methyl-1H-1,2,4-triazole-3,5-diyl)dipyridine) and thoroughly characterized them by different spectroscopic and analytical techniques such as FT-IR, 1H NMR, UV-vis spectroscopy and ESI mass spectra. The molecular structures of [1] and [2] are elucidated by single-crystal X-ray diffraction studies. Spectral properties and redox behaviour for both the complexes are examined. The complexes show phenoxazinone synthase activity under ambient conditions and thorough examination of the acquired spectroscopic data imply excellent reactivity for both. Kinetic parameters for both the complexes are evaluated and the turnover numbers (kcat value) of these two complexes are 201.24 h-1 and 249.57 h-1 for [1] and [2], respectively, which are quite high compared to those of previously reported similar complexes. The possible mechanistic route is also established with the help of mass spectroscopy and titrimetric analysis is performed to detect hydrogen peroxide that is a key intermediate formed in the catalysis and thus to prove the involvement of molecular oxygen in the oxidation. This report offers an in-depth summary of metal ion involvement and the extent of the phenoxazinone synthase activity. This journal is © The Royal Society of Chemistry and the Centre National de la Recherche Scientifique

Design, synthesis, structural, spectral, and redox properties and phenoxazinone synthase activity of tripodal pentacoordinate Mn(ii) complexes with impressive turnover numbers

Catechol oxidase (CO) and phenoxazinone synthase (PHS) are two enzymes of immense significance due to their capability to oxidize catechols and o-aminophenols to o-quinones and phenoxazinones, respectively. In this connection two mononuclear manganese complexes with the molecular framework [MnII(Ln)Cl]Cl {L1: tris((1H-benzo[d]imidazol-2-yl)methyl)amine; n = 1 and L2: tris(N-methylbenzimidazol-2-ylmethyl)amine; n = 2} have been designed to be potential catalysts for OAPH (o-aminophenol) oxidation. Both the ligands and their corresponding metal complexes have been successfully synthesized and thoroughly characterized by different spectroscopic and analytical techniques such as FT-IR, 1H NMR, UV-vis spectroscopy, EPR spectroscopy and ESI mass spectroscopy. The molecular structures of [MnII(L1)Cl]Cl (1) and [MnII(L2)Cl]Cl (2) have been revealed by a single-crystal X-ray diffraction study. The spectral properties and redox behaviour of both the complexes were examined. Under ambient conditions, 1 and 2 show excellent phenoxazinone synthase activity as both are very susceptible to oxidize o-aminophenol to phenoxazinone. The kinetic parameters for both complexes have been determined by analyzing the experimental spectroscopic data. The turnover numbers (kcat value) of these two complexes are extremely high, 440 h-1 and 234 h-1 for 1 and 2, respectively. The present report offers a thorough overview of information involving the role of the metal ions and their extent of phenoxazinone synthase mimicking activity. The oxidation of o-aminophenol to 2-amino-3H-phenoxazine-3-one (APX) by catalytic oxidation of oxygen (O2) by the reaction with transition metal complexes has been an important study for the last few decades. The current study evidently showed better performance of our synthesized Mn(ii) complexes than all the predecessors. The plausible mechanism has been reiterated based on the experimental data via ESI-MS spectra and considering the concepts from the previously reported mechanisms involved in the formation of hydrogen peroxide (H2O2) as an intermediate substrate is fairly indicating the involvement of molecular oxygen in the catalytic cycle. © 2021 The Royal Society of Chemistry

Ruthenium nitrosyl complexes with the molecular framework [RuII(dmdptz)(bpy)(NO)]n+ (dmdptz: N,N-dimethyl-4,6-di(pyridin-2-yl)-1,3,5-triazin-2-amine and bpy: 2,2′-bipyridine). Electronic structure, reactivity aspects, photorelease, and scavenging of NO

Two mononuclear ruthenium nitrosyl complexes with a nitrogen-rich ligand coordinated molecular framework, [RuII(dmdptz)(bpy)(NO)]n+ (dmdptz: N,N-dimethyl-4,6-di(pyridin-2-yl)-1,3,5-triazin-2-amine and bpy: 2,2′-bipyridine), Enemark and Feltham notation {RuNO}6, [4]3+ (n = 3), and {RuNO}7, [4]2+ (n = 2), have been synthesized by sequential pathways from a chloro precursor [RuII(dmdptz)(bpy)(Cl)]+ [1]+via an acetonitrile complex [RuII(dmdptz)(bpy)(CH3CN)]2+ [2]2+ and a nitro complex [RuII(dmdptz)(bpy)(NO2)]+ [3]+. Single crystal X-ray structures of [1](ClO4) and [3](ClO4) have been successfully elucidated. A substantial low stretching frequency ν(NO) band of [4]3+ at 1914 cm-1 due to the influence of a pyridyl-substituted s-triazine ligand suggests the moderately electrophilic nature of NO. Density functional theory calculated trans-angles (Ru1-N6-O1) of 176.713° and 141.745° in [4]3+ and [4]2+ indicate linear and bent coordination modes of NO to central ruthenium, respectively. A noticeable shift in ν(NO) (solid) (Δν = 364 cm-1) which has been observed on moving from [4]3+ to [4]2+ is good evidence for NO-centered one-electron reduction with {RuNO}6 to {RuNO}7 bonding alteration. The redox properties of [4]3+ have been studied with precursor complexes. The electrochemical conversion of [4]3+ to [3]+ has been performed in the presence of 0.5 M NaOH solution. Both [4]3+ and [4]2+ facilitate the photocleavage of the Ru-NO bond on exposure to a xenon 200 W visible light source with first-order rate constants kNO of 8.44 × 10-3 min-1 (t1/2 = 82 min) and 4.64 × 10-2 min-1 (t1/2 = 15 min), respectively. Light-triggered release of NO has been captured by a biologically relevant target protein, reduced myoglobin, as an Mb-NO adduct

Tetrazole-Substituted isomeric ruthenium polypyridyl complexes for low overpotential electrocatalytic CO2 reduction

Introducing tetrazole moiety to the ligand framework of two isomeric ruthenium catalysts, cis/trans-[Ru(tpy)(mtzp)(CH3CN)]2+ (tpy = 2,2′:6′,2′'-terpyridine, mtzp = 2-(1-methyl-1H-tetrazol-5-yl)pyridine), for the electrochemical reduction of CO2 to CO has altered the catalytic pathway with significantly low overpotential (0.37 V) compared to its analogous catalysts. Without manipulating steric effects, only the electronic nature of tetrazole moiety enables CO2 binding to ruthenium center to form metallocarboxylate intermediate just after one-electron reduction. This is the first synthesized isomeric pair of ruthenium complex follow ECE (E = electron transfer, C = chemical reaction) mechanism for electrocatalytic reduction of CO2. By successful characterization of the Ru–CO intermediate with the help of 13C NMR, spectro-electrochemical studies and analysis of byproducts formed during the electrocatalysis, a mechanism of CO2 reduction has been established in presence of water and anhydrous conditions which is further supported by density functional theory (DFT). © 2021 Elsevier Inc

Photolability of NO in ruthenium nitrosyls with pentadentate ligand induces exceptional cytotoxicity towards VCaP, 22Rv1 and A549 cancer cells under therapeutic condition

Pentadentate electron rich MePBITA ligand in [RuII(MePBITA)(NO)]n+ (n = 3, 2 and MePBITA = 1-(6-(1-methyl-1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine) permits the isolation of both the redox states of nitrosyls with Enemark–Feltham notation {RuNO}6 and {RuNO}7. The nitrosyl derivative [RuII(MePBITA)(NO)](ClO4)3: [4](ClO4)3 was synthesized by stepwise synthetic manner from the chloro precursor [RuII(MePBITA)(Cl)](PF6): [1](PF6), via the acetonitrile derivative [RuII(MePBITA)(CH3CN)](PF6)2: [2](PF6)2 followed by nitro complex [RuII(MePBITA)(NO2)](PF6): [3](PF6). All the complexes were fully characterized by different analytical and spectroscopic techniques. Single crystal X-ray structures of the complexes [1](PF6), [2](PF6)2, [3](PF6), and [4](ClO4)3 were profitably determined for understanding the molecular integrity. Ru−NO stretching frequency observed at 1931 cm−1 for [4](ClO4)3 suggests a moderately electrophilic character of NO. The huge shift in νNO frequency, Δν (solid) = 325 cm−1 was observed by reducing [4](ClO4)3 to [4](ClO4)2. The conversion of [3]+ from [4]3+ was examined both electrochemically and spectrophotometrically with the addition of 0.5 M NaOH solution. Rate constants of the first order photorelease (kNO) have been found to be 8.99 × 10−3 min−1; half-life (t1/2) = 77 min and 3.84 × 10−2 min−1; half-life (t1/2) = 18 min for [4]3+ and [4]2+, respectively with visible Xenon light (200 W) source. The photo liberated NO has been scavenged by biologically relevant target protein reduced myoglobin as Mb−NO adduct. Photoactivation of [4]3+ and [4]2+ by visible light induces significant cytotoxicity in prostate cancer cell lines; VCaP (IC50 29.74 and 4.42 µM) and 22Rv1 (IC50 29.96 and 6.88 µM), and lung cancer cell line; A549 (IC50 2.24 and 0.12 µM). Collectively our results pave the way for the development of metallodrugs as potential therapeutics for a variety of cancers. Additionally, our results also demonstrate how ligand modification could enhance the photolability of metal nitrosyl, adding a new dimension for future efficient photoactive metal nitrosyl design. © 2022 Elsevier B.V

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 μM)

Novel solid-phase strategy for the synthesis of ligand-targeted fluorescent-labelled chelating peptide conjugates as a theranostic tool for cancer

In this article, we have successfully designed and demonstrated a novel continuous process for assembling targeting ligands, peptidic spacers, fluorescent tags and a chelating core for the attachment of cytotoxic molecules, radiotracers, nanomaterials in a standard Fmoc solid-phase peptide synthesis in high yield and purity. The differentially protected Fmoc-Lys-(Tfa)-OH plays a vital role in attaching fluorescent tags while growing the peptide chain in an uninterrupted manner. The methodology is versatile for solid-phase resins that are sensitive to mild and strong acidic conditions when acid-sensitive side chain amino protecting groups such as Trt (chlorotrityl), Mtt (4-methyltrityl), Mmt (4-methoxytrityl) are employed to synthesise the ligand targeted fluorescent tagged bioconjugates. Using this methodology, DUPA rhodamine B conjugate (DUPA = 2-[3-(1,3-dicarboxypropyl)ureido]pentanedioic acid), targeting prostate specific membrane antigen (PSMA) expressed on prostate, breast, bladder and brain cancers and pteroate rhodamine B, targeting folate receptor positive cancers such as ovarian, lung, endometrium as well as inflammatory diseases have been synthesized. In vitro studies using LNCaP (PSMA +ve), PC-3 (PSMA −ve, FR −ve) and CHO-β (FR +ve) cell lines and their respective competition experiments demonstrate the specificity of the newly synthesized bioconstructs for future application in fluorescent guided intra-operative imaging

Synthesis, structure, spectral, redox properties and anti-cancer activity of Ruthenium(II) Arene complexes with substituted Triazole Ligands

Three versatile half-sandwich ruthenium(II) p-cymene complexes bearing substituted triazole ligands exhibit promising cancer cell growth inhibition activity towards A549 lung adenocarcinoma and MDA-MB-231 breast adenocarcinoma cells. In this context, the triazole based phthalimide protected new ligand (2-(3, 5-di(pyridin-2-yl)-4H-1,2,4-triazol-4-yl) isoindoline-1,3-dione) (L1) was prepared. Three ruthenium(II) p-cymene complexes [Ru(η6-p-cymene)(L1)Cl]Cl: [1]Cl, L1: (2-(3,5-di(pyridin-2-yl)-4H-1,2,4-triazol-4-yl)isoindoline-1,3-dione), [Ru(η6-p-cymene)(L2)Cl]Cl: [2]Cl and [Ru(η6-p-cymene)(L2)Cl](PF6): [2](PF6), L2 (2,2′-(4-(1H-pyrrol-1-yl)-4H-1,2,4-triazole-3,5-diyl) dipyridine) have been successfully synthesized and characterized by different spectral and analytical tools. Pyrrole protected substituted ruthenium complexes [2]Cl and [2](PF6) have been successfully identified structurally by single-crystal X-ray diffraction studies and confirmed the successful anion exchange. The redox properties of the ligands and the targeted metal complexes have been carefully examined. Cellular staining, live-cell imaging and MTT assay have been performed for all the complexes. We have demonstrated that our synthesized ruthenium(II) p-cymene complexes are capable of inducing significant cytotoxicity in A549 lung cancer cell lines, with an IC50 values of 6.56 ± 0.31 µM, 4.74 ± 0.2 µM and 13.67 ± 0.64 µM and in MDA-MB-231 breast cancer cell lines with an IC50 values of 1.13 ± 0.046 µM, 0.36 ± 0.016 µM and 11.32 ± 0.49 µM for [1]Cl, [2]Cl and [2](PF6) respectively. © 2021 Elsevier B.V