Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

Inhibition of NA-induced SRF activation by silodosin.

<p>Prostate tissue from each patient was allocated to three samples, which were stimulated with NA (30 µM) for 15 min, or remained unstimulated. Silodosin (3 µM) or solvent (3 µl DMSO) were added 15 min before NA as indicated. All samples were exposed for identical total periods to experimental conditions to prevent agonist-unspecific effects. In each experiment, SRF in NA-stimulated samples without silodosin ( = DMSO) was set to 100%, and values for samples with silodosin were referred to that sample. Shown are representative experiments, and densitometric quantification of all experiments (n = 6 patients; means±SEM).</p

Elk1 expression in human prostate tissue.

<p>(<b>A</b>), (<b>B</b>) Peroxidase staining of prostate tissues for Elk1. (<b>A)</b> Cytosolic Elk1 immunoreactivity in smooth muscle cells (smc). (<b>B</b>) Elk1-positive (Elk1⁺) and –negative (Elk1⁻) nuclei. (<b>C</b>) Peroxidase staining of prostate tissue for phospho-Elk1, with phospho-Elk-positive (pElk1⁺) nuclei. (<b>D</b>) Double fluorescence staining of human prostate tissue for Elk1 and αSMA. Yellow color in merged pictures represents Elk1 expression in smooth muscle cells. Shown are representative pictures from stainings from tissues of n = 6 patients for each staining.</p

Inhibition of NA-induced Elk1 activation by silodosin.

<p>Prostate tissue from each patient was allocated to three samples, which were stimulated with NA (30 µM) for 15 min, or remained unstimulated. Silodosin (3 µM) or solvent (3 µl DMSO) were added 15 min before NA as indicated. All samples were exposed for identical total periods to experimental conditions to prevent agonist-unspecific effects. In each experiment, Elk1 in NA-stimulated samples without silodosin ( =  DMSO) was set to 100%, and values for samples with silodosin were referred to that sample. (<b>A</b>) Inhibition of Elk1 activity by silodosin in NA-stimulated prostate samples (n = 6 patients), detected by EMSA. (<b>B</b>) Inhibition of Elk1 phosphorylation by silodosin in NA-stimulated prostate samples (n = 6 patients), assessed by Western blot analysis. Shown are representative experiments, and densitometric quantification of all experiments (means±SEM).</p

Adrenergic Elk1 phosphorylation in human prostate tissue.

<p>Prostate tissue from each patient was allocated to four samples, which were stimulated for indicated periods. Despite different stimulation periods, all samples were exposed for identical total periods to experimental conditions to prevent agonist-unspecific effects. Phosphorylation state of Elk1 and total Elk1 content was assessed by Western blot analysis. In each experiment, phospho-Elk1 and total Elk1 in unstimulated samples ( = 0 min) was set to 100%, and values for stimulated samples were referred to the unstimulated sample. (<b>A</b>) Stimulation with NA (n = 5 patients). (<b>B</b>) stimulation with the α1-AR agonist PE (n = 11 patients). Shown are representative Western blots, and densitometric quantification of all experiments (means±SEM).</p

NA-induced Elk1 and SRF activation in human prostate tissue.

<p>Prostate tissue from each patient was allocated to four samples, which were stimulated for indicated periods. Despite different stimulation periods, all samples were exposed for identical total periods to experimental conditions to prevent agonist-unspecific effects. Elk1 and SRF activities were asssessed by EMSA. Bands for active transcription factors (bound to DNA probes) were identified using negative controls, and are indicated by arrows. In each experiment, Elk1 or SRF in unstimulated samples ( = 0 min) was set to 100%, and values for stimulated samples were referred to the unstimulated sample. (<b>A</b>) NA-induced Elk1 activation (n = 9 patients). (<b>B</b>) NA-induced SRF activation (n = 9 patients). Shown are representative experiments, and densitometric quantification of all experiments (means±SEM).</p

SRF and myocardin expression in human prostate tissue.

<p>(<b>A</b>) Western blot analyses with prostate tissues from n = 8 patients, showing the expression of SRF, myocardin, αSMA, and β-actin. (<b>B</b>) Peroxidase staining of prostate tissues for SRF and myocardin (representative stainings of tissues from n = 6 patients). (<b>C</b>) Double fluorescence staining of prostate tissues for SRF and αSMA (representative stainings of tissues from n = 6 patients). Yellow color in merged pictures represents SRF expression in smooth muscle cells. (<b>D</b>) Double fluorescence staining of prostate tissues for SRF and myocardin (representative stainings of tissues from n = 6 patients). Yellow color in merged pictures represents colocalization of SRF and myocardin). In (<b>C</b>) and (<b>D</b>), examples for colocalization are indicated by arrows.</p