Distinct Roles of Receptor Phosphorylation, G Protein Usage, and Mitogen-Activated Protein Kinase Activation on Platelet Activating Factor-Induced Leukotriene C4 Generation and Chemokine Production

Platelet activating factor (PAF) interacts with cell surface G protein-coupled receptors on leukocytes to induce degranulation, leukotriene C4 (LTC4) generation, and chemokine CCL2 production. Using a basophilic leukemia RBL-2H3 cell line expressing wild-type PAF receptor (PAFR) and a phosphorylation-deficient mutant (mPAFR), we have previously demonstrated that receptor phosphorylation mediates desensitization of PAF-induced degranulation. Here, we sought to determine the role of receptor phosphorylation on PAF-induced LTC4 generation and CCL2 production. We found that PAF caused a significantly enhanced LTC4 generation in cells expressing mPAFR when compared with PAFR cells. In contrast, PAF-induced CCL2 production was greatly reduced in mPAFR cells. Pertussis toxin and U0126, which inhibit Gi and p44/42 mitogen-activated protein kinase (ERK) activation, respectively, caused very little inhibition of PAF-induced CCL2 production (∼20% inhibition). In contrast, these inhibitors almost completely blocked both PAF-induced ERK phosphorylation and LTC4 generation in PAFR cells. However, in mPAFR cells pertussis toxin only partially inhibited PAF-induced ERK phosphorylation. A Ca2+/calmodulin inhibitor had no effect on PAF-induced ERK phosphorylation in PAFR cells but completely blocked the response in mPAFR cells. These data demonstrate that receptor phosphorylation, which serves to desensitize PAF-induced LTC4 generation, is required for chemokine CCL2 production. They also indicate a previously unrecognized selectivity in G protein usage and ERK activation for PAF-induced responses. Whereas PAF-induced CCL2 production is, in large part, mediated independently of Gi activation or ERK phosphorylation, LTC4 generation requires ERK phosphorylation, which is mediated by different G proteins depending on the phosphorylation status of the receptor

C3a Enhances Nerve Growth Factor-Induced NFAT Activation and Chemokine Production in a Human Mast Cell Line, HMC-1

Activation of cell surface G protein-coupled receptors leads to transphosphorylation and activation of a number of receptor tyrosine kinases. Human mast cells express G protein-coupled receptors for the complement component C3a (C3aR) and high affinity nerve growth factor (NGF) receptor tyrosine kinase, TrkA. To determine whether C3a cross-regulates TrkA signaling and biological responses, we used a human mast cell-line, HMC-1, that natively expresses both receptors. We found that NGF caused tyrosine phosphorylation of TrkA, resulting in a sustained Ca2+ mobilization, NFAT activation, extracellular-signal regulated kinase (ERK) phosphorylation, and chemokine, macrophage inflammatory protein-1β (MIP-1β) production. In contrast, C3a induced a transient Ca2+ mobilization and ERK phosphorylation but failed to stimulate TrkA phosphorylation, NFAT activation, or MIP-1β production. Surprisingly, C3a significantly enhanced NGF-induced NFAT activation, ERK phosphorylation, and MIP-1β production. Pertussis toxin, a Gi/o inhibitor, selectively blocked priming by C3a but had no effect on NGF-induced responses. Mitogen-activated protein/ERK kinase inhibitor U0126 caused ∼30% inhibition of NGF-induced MIP-1β production but had no effect on priming by C3a. However, cyclosporin A, an inhibitor of calcineurin-mediated NFAT activation, caused substantial inhibition of NGF-induced MIP-1β production both in the absence and presence of C3a. These data demonstrate that NGF caused tyrosine phosphorylation of TrkA to induce chemokine production in HMC-1 cells via a pathway that mainly depends on sustained Ca2+ mobilization and NFAT activation. Furthermore, C3a enhances NGF-induced transcription factor activation and chemokine production via a G protein-mediated pathway that does not involve TrkA phosphorylation

In Vitro and In Vivo Evidence that Thrombospondin-1 (TSP-1) Contributes to Stirring- and Shear-Dependent Activation of Platelet-Derived TGF-β1

Thrombospondin 1 (TSP-1), which is contained in platelet α-granules and released with activation, has been shown to activate latent TGF-β1 in vitro, but its in vivo role is unclear as TSP-1-null (Thbs1−/−) mice have a much less severe phenotype than TGF-β1-null (Tgfb1−/−) mice. We recently demonstrated that stirring and/or shear could activate latent TGF-β1 released from platelets and have now studied these methods of TGF-β1 activation in samples from Thbs1−/− mice, which have higher platelet counts and higher levels of total TGF-β1 in their serum than wild type mice. After either two hours of stirring or shear, Thbs1−/− samples demonstrated less TGF-β1 activation (31% and 54% lower levels of active TGF-β1 in serum and platelet releasates, respectively). TGF-β1 activation in Thbs1−/− mice samples was normalized by adding recombinant human TSP-1 (rhTSP-1). Exposure of platelet releasates to shear for one hour led to near depletion of TSP-1, but this could be prevented by preincubating samples with thiol-reactive agents. Moreover, replenishing rhTSP-1 to human platelet releasates after one hour of stirring enhanced TGF-β1 activation. In vivo TGF-β1 activation in carotid artery thrombi was also partially impaired in Thbs1−/− mice. These data indicate that TSP-1 contributes to shear-dependent TGF-β1 activation, thus providing a potential explanation for the inconsistent in vitro data previously reported as well as for the differences in phenotypes of Thbs1−/− and Tgfb1−/− mice

Platelet-Activating Factor-Induced Chemokine Gene Expression Requires NF-κB Activation and Ca2+/calcineurin Signaling Pathways: Inhibition by Receptor Phosphorylation and β-Arrestin Recruitment

Previously, we reported that platelet-activating factor (PAF) stimulates higher G protein activation and a more robust Ca2+ mobilization in RBL-2H3 cells expressing earboxyl terminus deletion, phosphorylation-deficient mutant of PAF receptor (mPAFR) when compared with the wild-type receptor (PAFR). However, PAF did not provide sufficient signal for CC chemokine receptor ligand 2 (CCL2) production in cells expressing mPAFR. Based on these findings, we hypothesized that receptor phosphorylation provides a G protein-independent signal that synergizes with Ca2+ mobilization to induce CCL2 production. Here, we show that a mutant of PAFR (D289A), which does not couple to G proteins, was resistant to agonist-induced receptor phosphorylation. Unexpectedly, we found that when this mutant was coexpressed with mPAFR, it restored NF-κB activation and CCL2 production. PAF caused translocation of β-arrestin from the cytoplasm to the membrane in cells expressing PAFR but not a phosphorylation-deficient mutant in which all Ser/Thr residues were replaced with Ala (AST-PAFR). Interestingly, PAF induced significantly higher NF-κB and nuclear factor of activated T cells (NFAT)-luciferase activity as well as CCL2 production in cells expressing ΔST-PAFR than those expressing PAFR. Furthermore, a Ca2+/calcineurin inhibitor completely inhibited PAF-induced NFAT activation and CCL2 production but not NF-κB activation. These findings suggest that the carboxyl terminus of PAFR provides a G protein-independent signal for NF-κB activation, which synergizes with G protein-mediated Ca2+/calcineurin activation to induce CCL2 production. However, receptor phosphorylation and β-arrestin recruitment inhibit CCL2 production by blocking both NF-κB activation and Ca 2+/calcineurin-dependent signaling pathway

Molecular Characterization of the SHV-11 β-Lactamase of Shigella dysenteriae

A β-lactamase with an M(r) of 29,000 and a pI of 7.6 was partially purified from a clinical isolate of Shigella dysenteriae. The bla gene encoded the SHV-11 enzyme carrying the substitution Leu→Gln at position 35 and was linked to a strong promoter. This variant, unlike the prototype SHV-1 enzyme, hydrolyzed oxacillin, cloxacillin, and oxyiminocephalosporins such as cefotaxime

Mechanisms of Quinolone Resistance in Clinical Isolates of Shigella dysenteriae

In gram-negative bacteria, gyrase and topoisomerase IV are primary and secondary targets, respectively, of the fluoroquinolones. In addition to the mutations in the genes encoding the target enzymes (1, 4), quinolone resistance may also be associated with increased efflux of the drugs (2, 5). Possible mechanisms of quinolone resistance were investigated in clinical isolates of Shigella dysenteriae obtained from the International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh (AK) and the National Institute of Cholera and Enteric Diseases, Calcutta, India (CI, DS, IPB, and IMC). The quinolone resistance-determining regions (QRDR) of gyrA and parC were amplified with the primer pairs 5′TACACCGG TCAACAT TGAGG3′-5′T TAATGAT TGCCGCCG TCGG3′ and 5′GTATGCGATGTCTGAACTGGGCCTG3′-5′CGACAACCGGGATTCGGTG3′, respectively. The Ser83→Leu substitution appeared sufficient to confer high-level nalidixic acid resistance (MIC > 250 μg/ml) as determined by standard methods (3) (Table1). Four strains—DS-1, DS-2, CI-1, and CI-2—for which the norfloxacin MICs were 2 μg/ml and the ciprofloxacin MICs were between 0.5 and 1 μg/ml harbored the mutation Asp87→Gly in GyrA. None of the isolates examined had any mutations in the QRDR-encoding part of the parC gene