SYSTEMIC PHAEOHYPHOMYCOSIS DUE BY ALTERNARIA ALTERNATA: CASE REPORTS, IN-VITRO SENSITIVITY AND EXOANTIGEN STUDIES.

Alternaria alternata is the most frequently encountered species of Alternaria causing opportunistic mycoses. We report two cases of phaeohyphomycosis in which Alternaria alternata was isolated from peripheral blood samples of 35 year and 21 year old male TB and post operative patients respectively. The direct microscopic examination of the blood samples revealed dark dematiaceous, septate mycelium. A. alternata was repeatedly isolated from the clinical samples of both the patients. Ketoconazole with the MIC of 10 mgml-1 was found to be the best effective drug against both the Alternaria alternata strains tested in vitro. In the present study we tried to evaluate the role of exoantigens in the serological diagnosis of such infections. The exoantigen of A. alternate on SDS-PAGE analysis exhibited two bands of 15Kda and 67Kda. The antisera raised in rabbit against. A alternata exoantigen showed humoral response after one week of immunization of ODD method. No cross reactivity was seen with antisera raised in rabbit against Curvularia verreculosa and Cladosporum cladosporiodides. Formation of specific precipitin bands and no cross reactivity suggests the usefulness of Alternaria alternata exoantigen as diagnostic tool. The antisera analysis by SDS-PAGE revealed several additional bands particularly higher than 67 Kda molecular weight as compared to the normal (unchallenged) sera from the same rabbit. Whether any of these bands could be treated as specific marker for diagnosis needs further investigations. Keywords- opportunistic, phaeohypomycosis, Alternaria alternata, minimal inhibitory concentration (MIC

Integration of Various Infocommunication Technologies for Agricultural and Rural Development

No Abstrac

Preparation and evaluation of polyherbal facial scrub

The main objective of present study was to prepare a polyherbal scrub incorporated into gel. The use of natural ingredients to fight against acne, wrinkle and also to control secretion of oil is known as natural or herbal cosmetics. Herbal cosmeceuticals usually contain the plant parts which possess antimicrobial, antioxidant and anti aging properties. Herbal cosmetics are the safest product to use routine with no side effects and cosmeceuticals are the product which influences the biological function of skin. In this preparation Green apple , cinnamon, Millet, Sandalwood, Neem , Turmeric and honey is used as active ingredients and incorporated into the gel which is prepared with carbopol of different grades. Other ingredients like propylene glycol, Triethanolamine; methyl parahydroxy benzoate was added along with sodium lauryl sulfate into the gel. The prepared gel was evaluated for various parameters such as appearance, pH, viscosity, Spreadability, washability, irritability and found to be satisfied with all required characterizations. Thus, the developed formulation can be used as an effective scrub for using it to bear a healthy and glowing skin. Keywords:   Polyherbal, Antioxidant, Anti Aging, Less Abrasive, Skin Exfoliat

Systemic Phaeohyphomycosis Caused by Cladosporium Cladosporioides: In Vitro Sensitivity and its Serological Diagnosis

Phaeohyphomycosis is a clinical entity caused by dematiaceous fungi. Cladosporium cladosporioides is a phaeoid fungi commonly found in man’s environment and has been reported to cause infection in man.  We report a cause of pheohyphomycosis in a 60 year old male suffering from tuberculosis and gangrene. C. Cladoporioides was isolated from peripheral blood of the patient.  The direct microscopic examination of the blood sample revealed the presence of dark color dematiaceous septate & branched mycelium.                 In-vitro antifungal sensitivity of C. cladosporioides against Ketoconazole, Fluconazole, Itaconazole and Clotrimazole performed by Polak’s 1:3 dilution method.  Ketoconazole was the most effective drug against the isolated strain with MIC 10 ?g ml–1 after 96 hrs. of incubation. The exoantigen of C. cladosporioides was prepared and subjected to SDS PAGE (Polyacrylamide gel electrophoresis) analysis which revealed two bands of 15 and 67 K Dalton.  Antisera was raised against the antigen and subjected to ODD (Ouchterlony’s double diffusion) test which showed highly specific band of identity.  No cross reactivity was observed against the exoantigen of  C. cladosporioides with antisera of 2 strains of Curvularia verruculosa and one strain of Alternaria alternata. In this study it is concluded that cases of phaeohyphomycoses caused by C. cladosporioides can be rapidly diagnosed using exoantigenic method. Keywords; opportunistic, phaeohypomycosis, Cladosporium cladosporioides , minimal inhibitory concentration (MIC

Not Available

Not AvailableDuring the process of wine making different type wastes are generated. Generally, these wastes are not utilized widely and dumped in open fields without considering environmental issues. However, wastes generated by the wine industry have enormous properties. Among them, fine wine lees (FWL) from Cabernet Sauvignon wine is found with more nutraceutical properties and improved nutraceutical properties of ice creams in previous studies. Considering the importance of FWL and its suitability for improvement in ice cream quality, present study was carried out. FWL quantities of 0(T1), 4 (T2), 8(T3), 12(T4) and 16 (T5) percent added with absorbance durations of 1 (A1), 2 (A2) and 3 (A3) hrs were studied, and data were recorded on pH, protein, carbohydrate, anthocyanins, phenolics, antioxidant activities, water holding capacity and synersis of yoghurt samples. Absorbance duration and quantity of added FWL positively improved nutritional, functional and rheological properties of yoghurt in comparison with control. By increasing FWL quantity and absorbance duration, nutritional, functional and rheological properties of yoghurts were improved. On the basis of collected data, it is concluded that combination of 16% FWL with 3 h absorbance is found superior over other combinations.Not Availabl

Development and validation of mitochondrial DNA based approach for rapid identification of environmental chemical exposed victims

The rising toll of mortality due to different accidental or occupational environmental exposures necessitates early identification of exposed victims for their appropriate therapeutic intervention. However, this is mainly restricted by the lack of precise biomarkers and effective detection methodologies. Since, mitochondria are the prime target of different environmental exposures, these sub-cellular organelles offer possibilities of getting utilized for developing effective exposure associated strategies. The presence of unique inheritance pattern, rapid evolutionary rate, low recombination rate, higher copy number and resistance to degradation make mtDNA an important and indispensable tool for such studies. Therefore, we aim to design an mtDNA based molecular approach for rapid identification of the environmental chemical exposure associated victims. In order to analyze whole genome sequence of mtDNA, particular attention was devoted for primer selection from established libraries to adjust the melting temperature of all pairs. The specificity of selected primers was checked through BLAST analysis to avoid nDNA co-amplification. Total DNA was extracted from both human peripheral blood and lymphocytes and quantified for mtDNA amplification. Results of our PCR analysis showed clear amplification of whole ~16000 bp of mtDNA without co-amplification of NUMTs. Gel pictures showed the presence of a clear band of all the 9 fragments which correlated with their respective size. For absolute quantification real-time PCR analysis using primers for mt-ND1 (NADH dehydrogenase, subunit 1) gene (ND1-F, 50 CCCTAAAACCCGCCACATCT 30; ND1-R, 50 GAGCGATGGTGAGAGCTAAGGT 30) in mtDNA and other primer pair for the amplification of nuclear gene human (β-actin) was further performed. The ratio of mtDNA copy number to nDNA value was determined to identify absolute mtDNA copies (Mean 0.69 ± 0.05). After ascertaining the empty DNA copy numbers, the amplified products were purified for downstream mtDNA sequencing studies. The analysis was performed in collaboration with SciGenom Labs by using ABI 3730 XI equipped with 30 cm capillary array to facilitate the mtDNA fragment analysis. Currently, the investigations are ongoing and the obtained results may help to design novel mtDNA based fluorescence resonance energy transfer hybridization (FRET) - real time PCR assay for rapid identification of environmental chemical exposed victims

Not Available

Not AvailableCrop improvement is a continuous process in agriculture which ensures ample supply of food, fodder and fiber to burgeoning world population. Despite tremendous success in plant breeding and transgenesis to improve the yield-related traits, there have been several limitations primarily with the specificity in genetic modifications and incompatibility of host species. Because of this, new breeding techniques (NBTs) are gaining worldwide attention for crop improvement programs. Among the NBTs, genome editing (GE) using site-directed nucleases (SDNs) is an important and potential technique that overcomes limitations associated with classical breeding and transgenesis. These SDNs specifically target a compatible region in the gene/genome. The meganucleases (MgN), zinc finger nucleases (ZFN), transcription activator-like effectors nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated endonuclease (Cas) are being successfully employed for GE. These can be used for desired or targeted modifications of the native endogenous gene(s) or targeted insertion of cis/trans elements in the genomes of recipient organisms. Applications of these techniques appear to be endless ever since their discovery and several modifications in original technologies have further brought precision and accuracy in these methods. In this review, we present an overview of GE using SDNs with an emphasis on CRISPR/Cas system, their advantages, limitations and also practical considerations while designing experiments have been discussed. The review also emphasizes on the possible applications of CRISPR for improving economic traits in crop plants.Not Availabl

OPTIMIZATION OF COST FOR FARMERS OF COTTON BASED FARMING SYSTEM BY LINEAR PROGRAMMING MODEL

This paper illustrate the use of minimum cost linear programming technique for optimizing resources for the Vidarbha farmers. It compares the optimum farm planning developed by minimum cost strategies of management on small medium and large categories of farms and discusses the interrelationship between crop allocations made by the LP model and the existing farmer’s practice. Keywords: Linear programming, Profit maximization, Cost minimization, Agricultural crop