Mutations that Separate the Functions of the Proofreading Subunit of the Escherichia coli Replicase

The dnaQ gene of Escherichia coli encodes the Ɛ subunit of DNA polymerase III, which provides the 3\u27 - 5\u27 exonuclease proofreading activity of the replicative polymerase. Prior studies have shown that loss of Ɛ leads to high mutation frequency, partially constitutive SOS, and poor growth. In addition, a previous study from our laboratory identified dnaQ knockout mutants in a screen for mutants specifically defective in the SOS response after quinolone (nalidixic acid) treatment. To explain these results, we propose a model whereby, in addition to proofreading, Ɛ plays a distinct role in replisome disassembly and/or processing of stalled replication forks. To explore this model, we generated a pentapeptide insertion mutant library of the dnaQgene, along with site-directed mutants, and screened for separation of function mutants. We report the identification of separation of function mutants from this screen, showing that proofreading function can be uncoupled from SOS phenotypes (partially constitutive SOS and the nalidixic acid SOS defect). Surprisingly, the two SOS phenotypes also appear to be separable from each other. These findings support the hypothesis that Ɛ has additional roles aside from proofreading. Identification of these mutants, especially those with normal proofreading but SOS phenotype(s), also facilitates the study of the role of e in SOS processes without the confounding results of high mutator activity associated with dnaQ knockout mutants

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

SoS in Disasters: Why following the manual can be a mistake

According to both the US Geological Survey and the World Bank, $280 billion dollars could have been saved if$40 billion dollars had been invested in disaster prevention. Natural and human-made disasters that have occurred over the last few years show that there is a gap in disaster prevention caused by the interconnected nature of risks, which cannot be foreseen with current risk management methods. In this paper we point out how disaster management could benefit from a SoS approach in emergency response and preparedness strategies. Using recent disasters as case studies, we identify some keys to success in managing a SoS in preparation, during and in the aftermath of a disaster. In particular, we discuss the idea of the interconnectedness of risks in independent and interdependent systems and the application of Boardman and Sauser’s concept of “creative disobedience”, which are fundamental for goal achievement of systems belonging to a SoS

SOS system induction inhibits the assembly of chemoreceptor signaling clusters in Salmonella enterica

Swarming, a flagellar-driven multicellular form of motility, is associated with bacterial virulence and increased antibiotic resistance. In this work we demonstrate that activation of the SOS response reversibly inhibits swarming motility by preventing the assembly of chemoreceptor-signaling polar arrays. We also show that an increase in the concentration of the RecA protein, generated by SOS system activation, rather than another function of this genetic network impairs chemoreceptor polar cluster formation. Our data provide evidence that the molecular balance between RecA and CheW proteins is crucial to allow polar cluster formation in Salmonella enterica cells. Thus, activation of the SOS response by the presence of a DNA-injuring compound increases the RecA concentration, thereby disturbing the equilibrium between RecA and CheW and resulting in the cessation of swarming. Nevertheless, when the DNA-damage decreases and the SOS response is no longer activated, basal RecA levels and thus polar cluster assembly are reestablished. These results clearly show that bacterial populations moving over surfaces make use of specific mechanisms to avoid contact with DNA-damaging compounds

Analysis of the SOS response of Vibrio and other bacteria with multiple chromosomes

Background: The SOS response is a well-known regulatory network present in most bacteria and aimed at addressing DNA damage. It has also been linked extensively to stress-induced mutagenesis, virulence and the emergence and dissemination of antibiotic resistance determinants. Recently, the SOS response has been shown to regulate the activity of integrases in the chromosomal superintegrons of the Vibrionaceae, which encompasses a wide range of pathogenic species harboring multiple chromosomes. Here we combine in silico and in vitro techniques to perform a comparative genomics analysis of the SOS regulon in the Vibrionaceae, and we extend the methodology to map this transcriptional network in other bacterial species harboring multiple chromosomes. Results: Our analysis provides the first comprehensive description of the SOS response in a family (Vibrionaceae) that includes major human pathogens. It also identifies several previously unreported members of the SOS transcriptional network, including two proteins of unknown function. The analysis of the SOS response in other bacterial species with multiple chromosomes uncovers additional regulon members and reveals that there is a conserved core of SOS genes, and that specialized additions to this basic network take place in different phylogenetic groups. Our results also indicate that across all groups the main elements of the SOS response are always found in the large chromosome, whereas specialized additions are found in the smaller chromosomes and plasmids. Conclusions: Our findings confirm that the SOS response of the Vibrionaceae is strongly linked with pathogenicity and dissemination of antibiotic resistance, and suggest that the characterization of the newly identified member

Toward a theory of complexity escalation and collapse for system of systems

In this paper we urge the creation of new managerial tools and techniques that are relevant to the complexity of today’s system of systems (SOS). Normal modes of command and control systems cannot be effective under conditions where new constraints are added on a recurrent basis to the system of systems in response to emergent problems within the systems due to increased coupling introduced in component elements of the SOS. We present a first-step understanding of why unanticipated failures find more potential and more pathways to their occurrence when interventions in SOS operations, standards or processes are conducted without enough insight and without a care for basic laws of complexity. We then demonstrate a condition where the incremental changes actually lead to failure of the SOS to meet its performance parameters. We hope that this work set the foundation for exploring the effects of coupling across hierarchical levels of SOS

Correlates of calcaneal quantitative ultrasound parameters in patients with diabetes: the study on the assessment of determinants of muscle and bone strength abnormalities in diabetes

OBJECTIVE: Quantitative ultrasound (QUS) provides an estimate of bone mineral density (BMD) and also evaluates bone quality, which has been related to increased fracture risk in people with diabetes. This study aimed at assessing the correlates of calcaneal QUS parameters in diabetic subjects encompassing various degrees of micro and macrovascular complications and a wide-range of peripheral nerve function. METHODS: Four hundred consecutive diabetic patients were examined by QUS to obtain values of broadband ultrasound attenuation (BUA), the speed of sound (SOS), quantitative ultrasound index (QUI), and BMD. RESULTS: Among surrogate measures of complications, sensory and motor nerve amplitude and heart rate response to cough test and standing correlated with QUS parameters at univariate analysis, together with age, body mass index (BMI), waist circumference, lipid profile, and renal function. Multivariate analysis revealed that BUA, SOS, QUI, and BMD were independently associated with age, male gender, hemoglobin A1c, BMI (or fat, but not fat-free mass), and somatic and autonomic nerve function parameters. CONCLUSIONS: These data indicate that peripheral nerve dysfunction is associated with worse QUS parameters, possibly contributing to increased fracture risk in diabetes. The positive relation of QUS measures with adiposity needs further investigation. This trial is registered with ClinicalTrials.gov (NCT01600924)

Transcriptional profiling of colicin-induced cell death of Escherichia coli MG1655 identifies potential mechanisms by which bacteriocins promote bacterial diversity

We report the transcriptional response of Escherichia coli MG1655 to damage induced by colicins E3 and E9, bacteriocins that kill cells through inactivation of the ribosome and degradation of chromosomal DNA, respectively. Colicin E9 strongly induced the LexA-regulated SOS response, while colicin E3 elicited a broad response that included the induction of cold shock genes, symptomatic of translational arrest. Colicin E3 also increased the transcription of cryptic prophage genes and other laterally acquired mobile elements. The transcriptional responses to both these toxins suggest mechanisms that may promote genetic diversity in E. coli populations, pointing to a more general role for colicins in adaptive bacterial physiology than has hitherto been realized

No Consistent Evidence for Advancing or Delaying Trends in Spring Phenology on the Tibetan Plateau

Vegetation phenology is a sensitive indicator of climate change and has significant effects on the exchange of carbon, water, and energy between the terrestrial biosphere and the atmosphere. The Tibetan Plateau, the Earth\u27s “third pole,” is a unique region for studying the long‐term trends in vegetation phenology in response to climate change because of the sensitivity of its alpine ecosystems to climate and its low‐level human disturbance. There has been a debate whether the trends in spring phenology over the Tibetan Plateau have been continuously advancing over the last two to three decades. In this study, we examine the trends in the start of growing season (SOS) for alpine meadow and steppe using the Global Inventory Modeling and Mapping Studies (GIMMS)3g normalized difference vegetation index (NDVI) data set (1982–2014), the GIMMS NDVI data set (1982–2006), the Moderate Resolution Imaging Spectroradiometer (MODIS) NDVI data set (2001–2014), the Satellite Pour l\u27Observation de la Terre Vegetation (SPOT‐VEG) NDVI data set (1999–2013), and the Sea‐viewing Wide Field‐of‐View Sensor (SeaWiFS) NDVI data set (1998–2007). Both logistic and polynomial fitting methods are used to retrieve the SOS dates from the NDVI data sets. Our results show that the trends in spring phenology over the Tibetan Plateau depend on both the NDVI data set used and the method for retrieving the SOS date. There are large discrepancies in the SOS trends among the different NDVI data sets and between the two different retrieval methods. There is no consistent evidence that spring phenology (“green‐up” dates) has been advancing or delaying over the Tibetan Plateau during the last two to three decades. Ground‐based budburst data also indicate no consistent trends in spring phenology. The responses of SOS to environmental factors (air temperature, precipitation, soil temperature, and snow depth) also vary among NDVI data sets and phenology retrieval methods. The increases in winter and spring temperature had offsetting effects on spring phenology