Location of Repository

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

By Ricardo M. F. Leal, Shirley Callow, Phil Callow, Matthew P. Blakeley, Christine J. Cardin, William A. Denny, Susana C. M. Teixeira, Edward P. Mitchell and V. Trevor. Forsyth

Abstract

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.\ud \u

Publisher: John Wiley & Sons for the International Union of Crystallography
Year: 2010
OAI identifier: oai:centaur.reading.ac.uk:16153
Download PDF:
Sorry, we are unable to provide the full text but you may find it at the following location(s):
  • http://dx.doi.org/10.1107/S090... (external link)
  • http://www.reading.ac.uk/chemi... (external link)
  • Suggested articles


    To submit an update or takedown request for this paper, please submit an Update/Correction/Removal Request.