Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Leal, Ricardo M. F.; Callow, Shirley; Callow, Phil; Blakeley, Matthew P.; Cardin, Christine J.; Denny, William A.; Teixeira, Susana C. M.; Mitchell, Edward P.; Forsyth, V. Trevor.

oai:centaur.reading.ac.uk:16153

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Authors: Ricardo M. F. Leal
Shirley Callow
Phil Callow
Matthew P. Blakeley
Christine J. Cardin
William A. Denny
Susana C. M. Teixeira
Edward P. Mitchell
V. Trevor. Forsyth
Publication date: 1 November 2010
Publisher: John Wiley & Sons for the International Union of Crystallography
Doi

Abstract

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction

Similar works

Full text

Central Archive at the University of Reading

oai:centaur.reading.ac.uk:1615...

Last time updated on 01/07/2012

This paper was published in Central Archive at the University of Reading.

Having an issue?

Is data on this page outdated, violates copyrights or anything else? Report the problem now and we will take corresponding actions after reviewing your request.