Comptes Rendus Chimie

Astrid Walrant

Farah Tazi

Sonia Khemaissa

Sandrine Sagan

Molecular aspects of cell-penetrating peptides: key amino acids, membrane partners, and non-covalent interactions

Angelique Pothuizen

Rosalie I. Wouters

Hugo Brasselet

Thomas Hilberath

Yinqi Wu

Frank Hollmann

Supporting Information From characterization to biocatalytic application of two peroxygenases from Collariella virescens and Daldinia caldariorum  Angelique Pothuizen1ǂ, Rosalie I. Wouters1ǂ, Hugo Brasselet1, Thomas Hilberath1, Yinqi Wu1 and Frank Hollmann1*1. Gene sequences for Unspecific Peroxygenases from Collariella virescens and Daldinia caldariorum Both Unspecific Peroxygenase genes were codon optimized for E. coli and cloned into a pET-28a expression plasmid under control of the T7 promoter. Both sequences contain an N-terminal 6HisTag which is underlined in the DNA sequence.  Gene sequence Collariella virescens Unspecific Peroxygenase (CviUPO) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGAACTGGACTTTAGTAAATGGAAGACCCGTCAGCCGGGCGAATTCCGTGCCCCGTGCCCGGCTATGAATTCTCTGGCCAACCACGGTTTTATCCCGCGCGATGGCCGTAATATTACCGTAGCCATGCTGGTTCCGGTCCTGCAGGAGGTCTTCCACCTGTCCCCAGAGCTGGCGCAGACGATCTCTACTCTGGGTCTGTTTACCGCTCAAGACCCTTCCAAAGGCGTATTCACTCTAGACGACCTGAACCGCCATAACCTGTTTGAACATGATGCATCTCTGTCTCGTGAAGATTACTATTTCCACAAAGATGCATCTACCTTCCGTCCGGAAGTTTTCAAGAAGTTCATGTCCCACTTTAAAGGCAAGGAATATGTTACTCTGGAAGACGCAGCTAGCGCCCGTTATGCAATGGTACAGGAAAGCCGCAAAAAAAACCCGACTTTCACTTACACCGTTCAGCAGCGTATCACCAGTTACGGTGAAACGATTAAATATTTCCGTACCATTGTTGAACCGGCTACTGGCAAGTGCCCGGTTGCGTGGATTAAGATCCTGTTTGAACAGGAGCGACTGCCGTACAACGAGGGTTGGCGTCCGCCTAAAGCTGAACTGTCTGGCTTTAGTATGGCATCCGATGTCCTGGAGCTGGCGTTAGTGACCCCGGAAAAACTGATCGACAAACCGTGTGAAGGCAAACAGTGCCCGCAAGCCCGCGGCATCCACGGTTACTTCGGCATGCTGCTGCCGATCACTGCGCAGGAACTGGCAGTTAAGTAA Gene sequence for Daldinia caldariorum Unspecific Peroxygenase (DcaUPO) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCACCGTGGAAAGCTCCTGGTCCGGACGACGTTCGCGGTCCGTGTCCAATGCTGAATACACTGGCTAACCACGGTTTCCTGCCGCACGACGGTAAAAACATTGACGTTAATACCACCGTGAACGCTCTGTCCTCCGCGCTGAACCTGGACGACGAATTATCCCGCGATCTGCACACCTTCGCAGTGACGACCAACCCGCAGCCGAACGCTACGTGGTTTAGCCTGAACCACTTATCCCGCCACAATGTGCTGGAACACGATGCATCTCTGTCCCGCCAGGATGCGTATTTCGGTCCACCTGATGTTTTCAACGCGGCTGTGTTCAATGAAACCAAGGCTTATTGGACAGGCGACATCATTAACTTCCAGATGGCTGCGAACGCGTTGACCGCGCGTCTGATGACCTCCAACCTGACTAACCCGGAATTCTCTATGTCCCAGCTGGGTCGTGGCTTCGGTCTGGGCGAAACTGTTGCTTATGTAACTATCCTGGGCTCTAAAGAAACACGCACTGTACCGAAGGCGTTTGTTGAATACCTGTTCGAAAACGAACGTCTGCCGTACGAACTGGGTTTTAAAAAGATGAAATCTGCTCTGACTGAAGATGAACTGACTACCATGATGGGTGAAATTTATTCTCTGCAACACCTGCCGGAAAGCTTTACCAAACCGTTCGCAAAACGTAGCGAAGCGCCGTTCGAAAAACGTGCGGAAAAACGCTGCCCGTTCCACTAA   2. Analytical methods for GC and GC-MS analysis   GC analysis was performed on a Shimadzu GC-2010 Plus system with an AOC-20i autosampler, AOC-20s carrousel and a FID-2010 Plus detector. Different columns were used for analysis of different substrates (Table S1). GC-MS analysis was performed on a Shimadzu GC-2010 system with AOC-20i autosampler and a GCMS-GP2010S mass spectrometer detection system equipped with a Optima 1 (25m x 0.25 mm x 0.25 μm) column, see table S1 for temperature programs. Reactions were stopped by addition of ethyl acetate containing n-Dodecane (5mM) as internal standard. Reactions were subjected to liquid-liquid extraction and centrifugation after which the organic phase was subjected to GC(-MS) analysis.   Table S1. GC and GC-MS analytics. Linear velocity is 30 cm/sec, unless otherwise indicated.  Column Temperature program / gradient Retention time GC CP wax 52 CB (Agilent) (25 m × 0.25 mm × 1.2 µm) carrier gas: N2 120 °C 30 °C/min to 160°C, hold 5 min 30 °C/min to 245, hold 3 min 3.34 min n-Dodecane (IS) 3.45 min heptan-2-one 4.15 min heptan-2-ol 4.21 min octan-2-one 5.22 min octan-2-ol  5.79 min heptan-1-ol 7.53 min octan-1-ol  GC Hydrodex β-TBDM (MACHEREY-NAGEL) (50m x 0.25 mm x 0.15 µm) carrier gas: He 65 °C, hold 50 min 25 °C/min to 180 °C, hold 1 min 25 °C/min to 250 °C, hold 1 min Linear velocity : 38 cm / sec 20.9 min heptan-2-one  45.7 min R-heptan-2-ola 46.7 min S-heptan-2-ola  55.4 min n-Dodecane (IS)  GC CP-Chirasil-DEX CB (Agilent) (25 m × 0.32 mm × 0.25 μm) carrier gas: He 70 °C, hold 47.5 min 25 °C/min to 120 °C, hold 1 min 25 °C/min to 225 °C, hold 1 min  18.3 min 2-octanone 43.8 min R-octan-2-ol  44.7 min S-octan-2-ol  50.1 min n-Dodecane (IS) GC CP wax 52 CB (Agilent) (25 m × 0.25 mm × 1.2 µm) carrier gas: N2 120 °C, hold 5 min 30 °C/min to 140 °C, hold 1.5 min 30 °C/min to 180 °C, hold 1.5  min 30 °C/min to 245 °C, hold 1 min 4.67 min n-Dodecane (IS) 6.71 min oct-1-en-3-one 8.67 min oct-1-en-3-ol  GC CP-sil 8 CB (Agilent) (25m x 0.25mm x 1.2 µm) carrier gas: N2 120 °C, hold 3 min 15 °C/min to 245 °C, hold 3.33 min 30 °C/min to 340 °C, hold 1 min 8.15 min n-Dodecane (IS) 8.94 min 4-phenylbutan-2-one 12.41 min rhododendrol   GC CP-Chirasil-DEX CB (Agilent) (25 m × 0.32 mm × 0.25 μm) carrier gas: He 120 °C, hold 2.6 min 15 °C/min to 135 °C, hold 3.3 min 25 °C/min to 225 °C, hold 1 min 2.38 min ethylbenzene 4.17 min acetophenone 4.59 min n-Dodecane (IS) 6.15 min R-1-phenylethan-1-ol 6.41 min S-1-phenylethan-1-ol GC CP-sil 8 CB (Agilent) (25m x 0.25mm x 1.2 µm) carrier gas: N2 120 °C, hold 3.5 min 30 °C/min to 180°C, hold 1 min 30 °C/min to 240 °C, hold 2 min 30 °C/min to 340, hold 1 min 3.15 min toluene  5.27 min pseudocumene 6.06 min p-cymene 7.82 min n-Dodecane (IS) 8.72 min thymol GC CP-sil 8 CB (Agilent) (25m x 0.25mm x 1.2 µm) carrier gas: N2 110 °C, hold 3 min 30 °C/min to 160 °C, hold 8.33 min 30 °C/min to 340 °C, hold 1 min 5.26 min styrene  6.42 min alpha methyl styrene 6.70 min cis-beta-methyl styrene  7.18 min trans-beta-methyl styrene 7.57 min phenyl acetaldehyde 8.10 min styrene oxide  8.42 min alpha methyl styrene    oxide 8.71 min phenyl propanal 8.88 min cis-beta-methyl styrene oxide  9.12 min trans beta-methyl styrene oxide 9.41 min phenyl acetone  10.9  min n-Dodecane (IS) 13.91 min cinnamaldehyde 14.42 min phenyl-1,2-propanediol 14.51 min cinnamyl alcohol  GC CP-sil 8 CB (Agilent) (25m x 0.25mm x 1.2 µm) carrier gas: N2 90 °C, hold 3 min 25 °C/min to 289 °C, hold 2 min 25 °C/min to 340 °C, hold 1 min 6.34 min alpha pinene 7.30 min limonene 7.48  min n-Dodecane (IS) 8.08 min alpha pinene oxide  8.24 min camphenol 8.29 min cis- limonene oxide  8.42 min verbenol 9.67 min limonene dioxide  10.9 min beta-ionone 11.6 min 7,11-Epoxymegastigma-5(6)-en-9-one 12.0 min 4-Hydroxyy Beta Ionone GC CP-sil 8 CB (Agilent) (25m x 0.25mm x 1.2 µm) carrier gas: N2 180 °C, hold 5 min  30 °C/min to 280 °C, hold 5 min  30 °C/min to 340 °C, hold 1 min 3.37 min thioanisole  4.16 min n-Dodecane (IS) 4.50 min methyl p-tolyl sulfide  6.23 min methyl phenyl sulfoxide 6.83 min methyl phenyl sulfone 7.52 min methyl p-tolyl sulfoxide 8.03 min methyl p-tolyl sulfone  GC-MS  Optima 1  (MACHEREY-NAGEL) (25m x 0.25mm x 0.25 µm)  Carrier gas: He 120 °C, hold 7 min  30 °C/min to 180 °C, hold 1 min  30 °C/min to 240 °C, hold 2 min  30 °C/min to 340 °C, hold 1 min  MS detection started after 3 min 5.35 min n-Dodecane (IS) 5.61 min thymohydroquinone 5.97 min thymol   a Chiral reference compounds were unavailable for this substrate. Identification of R- and S- elution times are based on observation that for both octan-2-ol and 1-phenylethan-1-ol the R-enantiomer elutes first.    3. Chiral analysis of alcohol oxidation  Chromatograms of chiral analysis of enantiomers of 2-octanol and 1-phenylethanol. The top chromatogram shows chiral analysis of the enantiomers of octan-2-ol. In the top chromatogram,  the pink line shows the R- and S-enantiomer peaks of octan-2-ol at t=0 of the enzymatic reaction. The blue line shows remaining peaks to the R- and S-enantiomers of octan-2-ol after a reaction time of 3 hours with the DcaUPO. The black line in the chromatogram shows the peak for R-octan-2-ol as authentic standard. A slight preference for the consumption of R-octan-2-ol can be observed. The bottom chromatogram shows the chiral analysis of 1-phenyletahnol. The blue line in this chromatogram shows the starting point of both enantiomers at t=0 in the enzymatic reaction. The black line shows the remaining peaks of the R- and S-enantiomers of 1-phenylethanol after a reaction time of 3 hours with the CciUPO whereas the pink line shows the remaining peaks of the R- and S-enantiomers of 1-phenylethanol after a reaction time of 3 hours with the DcaUPO. A slight preference for the consumption of the R-enantiomer is observed for the DcaUPO.     Figure S1: chromatograms of chiral GC analysis of octan-2-ol (top) and 1-phenylethanol (bottom). In the top chromatogram, the pink line shows the starting point of both the R- and S- enantiomers for octan-2-ol. The blue line shows the remaining R- and S-enantiomers after a reaction time of 3hours with DcaUPO. Black line shows authentic standard for R-octan-2-ol. In the bottom chromatogram, the blue line shows the starting points of both the R- and S-enantiomer of 1-phenylethanol. The black line shows the remaining R- and S-enantiomer peaks after a reaction time of 3 hours with the CciUPO, the pink line shows the remaining R- and S-enantiomer peaks after a reaction time of 3 hours with the DcaUPO.    4. GC-MS spectra of thymol, pseudocumene and products GC-MS spectra of thymol and product (Figure S2) compared to reference GS-MS spectra and GC-MS spectra of pseudocumene and product (Figure S3) compared to reference GC-MS spectra.    Figure S2: GC-MS spectra of thymol, the observed reaction product and comparisons to reference GC-MS spectra. A: GC-MS spectra of the substrate thymol, B: GC-MS reference spectra of thymol, C: GC-MS spectra of the observed product of the reaction with DcaUPO, D: Reference GC-MS spectrum of the presumed product, thymoquinone.   Figure S3: GC-MS spectra of pseudocumene, the observed reaction product and reference spectra of potential products. A: GC-MS spectra of the substrate pseudocumene, B: GC-MS reference spectra of pseudocumene, C: GC-MS spectra of the observed product of the reaction with DcaUPO, D and E: Reference GC-MS spectra of the potential products.  

From characterization to biocatalytic application of two peroxygenases from Collariella virescens and Daldinia caldariorum

Amelia K. Gilio

Miguel A. Abdo

Carlos A. Martinez

Andrew T. Palaia

Jovan Livada

Practical examples of biocatalysis in industry

Clotilde Policar

Christine Rampon

Alice Balfourier

Michel Volovitch

Sophie Vriz

Hélène Charlotte Bertrand

Nicolas Delsuc

Inorganic chemical biology and metal complexes in cells: from the design of cellular models to evaluate antioxidant activity to the characterization of metal complexes in cells

Esther Pruna Cortada

Sílvia Osuna

Shortest Path Map correlation-based tool for capturing functionally relevant allosteric networks and its application in enzyme design

Alice Am

Laura Trapiella-Alfonso

Camille Lescot

Bich-Thuy Doan

Fanny d’Orlyé

Anne Varenne

From design to formulation of peptide building blocks for nanotheranostic applications: a synergistic multidisciplinary investigation

Hippolyte Meersseman Arango

Patricia Luis

Tom Leyssens

Damien P. Debecker

Enzyme-membrane reactors: recent trends and applications for the production of fine chemicals and pharmaceutical building blocks

Alain Rabion

Davide Panigada

Sebastien Roy

Antony Bigot

Jason S. Tedrow

Accelerating the implementation of biocatalysis in pharmaceutical research and development portfolio

Sarah Westarp

Peter Neubauer

Anke Kurreck

Nucleoside chemistry: a challenge best tackled together

Keyu Mao

Kristina Plevova

Xi Chen

Laura Juliana Prieto Pabon

Sophie  Poulain-Martini

Véronique Michelet

Silver-, gold-, and platinum-catalyzed [4+2] cyclizations: synthesis of 2,3,3a,4-tetrahydro-1H-benzo[f]isoindol-1-one derivatives

Not a member yet

Molecular aspects of cell-penetrating peptides: key amino acids, membrane partners, and non-covalent interactions

From characterization to biocatalytic application of two peroxygenases from <i>Collariella virescens</i> and <i>Daldinia caldariorum</i>