Abstract: 2-oxoglutarate (2-OG or α-ketoglutarate) relates mitochondrial metabolism to cell function by modulating the activity of 2-OG dependent dioxygenases involved in the hypoxia response and DNA/histone modifications. However, metabolic pathways that regulate these oxygen and 2-OG sensitive enzymes remain poorly understood. Here, using CRISPR Cas9 genome-wide mutagenesis to screen for genetic determinants of 2-OG levels, we uncover a redox sensitive mitochondrial lipoylation pathway, dependent on the mitochondrial hydrolase ABHD11, that signals changes in mitochondrial 2-OG metabolism to 2-OG dependent dioxygenase function. ABHD11 loss or inhibition drives a rapid increase in 2-OG levels by impairing lipoylation of the 2-OG dehydrogenase complex (OGDHc)—the rate limiting step for mitochondrial 2-OG metabolism. Rather than facilitating lipoate conjugation, ABHD11 associates with the OGDHc and maintains catalytic activity of lipoyl domain by preventing the formation of lipoyl adducts, highlighting ABHD11 as a regulator of functional lipoylation and 2-OG metabolism

Antrobus, Robin

Bailey, Peter S. J.

Burr, Stephen P.

Costa, Ana S. H.

Frezza, Christian

Houghton, Jack W.

Martinelli, Anthony W.

Nathan, James A.

Ortmann, Brian M.

Nature Communications

Apollo (Cambridge)

 1 Supplementary Information			ABHD11	maintains	2-oxoglutarate	metabolism	by	preserving	functional	lipoylation	of	the	2-oxoglutarate	dehydrogenase	complex   Bailey et al.     2 Supplementary Figure 1. ABHD11 loss leads to HIF-1⍺ accumulation and inhibition of 2-OG dependent dioxygenases in aerobic conditions.  (a) Schematic of HRE-GFPODD reporter. (b-d) HeLa HRE-GFPODD cells respond to oxygen and metabolic inhibition. In 21% oxygen (O2), GFP reporter levels are low (black line). Reporter  3 cells incubated for 24 hours in 1% O2 (b) or following treatment with 1 mM DMOG (c), or 4 mM dimethyl 2-OG (DM-2OG) (d) accumulate GFP. n=10,000 cells per sample (b-d). (e, f) ABHD11 depletion leads to HIF-1a accumulation in cells incubated in 21% oxygen. HeLa HRE-GFPODD cells (e) or HeLa wildtype cells (f) expressing Cas9 were lentivirally transduced with up to 3 sgRNA targeting ABHD11 and HIF-1a levels measured by immunoblot. b-actin served as a loading control. (g) HIF-1a prolyl hydroxylation levels in HeLa cells following ABHD11 depletion, DMOG treatment or VHL inhibition. Control or ABHD11 deficient HeLa cells were generated as described. Hela cells were treated with indicated concentration of DMOG for 24 hr or the VHL inhibitor VH298 for 2 hours. Total HIF-1a and prolyl hydroxylated HIF-1a (OH-HIF-1a) were measured by immunoblot. (h, i) In vitro prolyl hydroxylation of HIF-1a. Recombinant HIF-1a, encoding the C-terminal ODD region (aa 530 – 652), was incubated with cell extracts from control, ABHD11 deficient or LIAS deficient cells for 15 min at 37°C. Total HIF-1aODD and prolyl hydroxylated HIF-1aODD (OH-HIF-1a) were measured by immunoblot (h) and quantified using ImageJ (i). n=4 (representative image shown), mean ± SEM, two-tailled t test. (j) 5hmC levels are reduced in ABHD11 depleted cells. Genomic DNA was extracted from Hela control or mixed KO populations of ABHD11, LIAS or VHL, and 5hmC levels measured by immunoblot, compared to total DNA content measured by methylene blue stain (Figure 1j). (k) Effect of ABHD11 loss on histone methylation marks. Control, ABHD11, OGDH or LIAS deficient HeLa cells were generated as previously described. Wildtype Hela cells were also treated with DM2-OG (6mM 24hr) as indicated. H3K4me3, H3K9me3 and total H3 levels were measured by immunoblot. Short and long lipoate immunoblot exposures are shown.    4 Supplementary Figure 2. ABHD11 is a member of the ab hydrolase domain containing family  (a) Hierarchical clustering of canonical protein sequences of ABHD family members using Clustal Omega. ABHD11 and ABHD10 contain mitochondrial targeting sequences (MTS). (b) Multiple sequence alignment of the canonical transcript variant of ABHD family members using Cluistal Omega, showing the regions aligning to ABHD11 active site residues serine 141 and histidine 296. Residues are coloured by amino acid properties (red: small/hydrophobic; blue: acidic; magenta: basic; green: hydroxyl/sulfhydryl/amine, or glycine).      5 Supplementary Figure 3. ABHD11 is a mitochondrial matrix hydrolase.   (a, b) Confocal immunofluorescence microscopy of Hela cells stably expressing ABHD11-GFP, ABHD11 S141-GFP or ABHD11 H296A-GFP (a). MitoTracker Deep Red was used to visualise mitochondria. Pearson correlation coefficient was used to quantify ABHD11 colocalisation with mitochondria (b). Scale=10µm. *p=0.017, two-tailed Mann Whitney U test.  ns=not significant (S141A vs wt: p=0.90; H296A vs wt: p=0.32).    6 Supplementary Figure 4. Affinity purification of ABHD11-FLAG.  (a) Purification of wildtype or S141A mutant ABHD11 from human cells. HEK293T cells were transfected with wildtype of S141A ABHD11-FLAG. Cells were lysed after 48 hr (left panel)  7 and ABHD11 affinity purified using anti-FLAG affinity beads and FLAG peptide elution (middle (immunoblot) and right panel (Coomassie staining)). The pre-cleaved (pABHD11) and mitochondrial cleaved (mABHD11) forms are indicated. (b) Mass spectrometry (MS) sequence analysis of affinity purified ABHD11-FLAG expressing HEK293T cells. Affinity purified ABHD11 was subjected to SDS-PAGE and analysed by MS using three different peptide digests (Trypsin, AspN or GluC). Complete peptide coverage was observed aside from the first 21 residues encoding the mitochondrial targeting sequence and TOM20 recognition motif.  (c, d) Size exclusion chromatography of ABHD11-FLAG. Affinity purified ABHD11-FLAG was subjected to gel filtration using a Superdex 75 10/300 GL column. Two peaks were visualised, potentially corresponding to monomeric and dimeric forms. ABHD11-FLAG was only visualised in the second peak elution (d).     8 Supplementary Figure 5. ABHD11 loss does not alter PDHc activity.   (a) Lipoylation of immunoprecipitated DLST. Control, ABHD11 mixed KO or LIAS mixed KO cells were lysed in 1% IGEPAL CA-630 and DLST immunoprecipitated. DLST and lipoylated DLST levels are shown. HC = heavy chain. (b) Lipoylation of immunoprecipitated DLAT. Control, ABHD11 mixed KO or LIAS mixed KO cells were lysed in 1% IGEPAL CA-630 and DLAT immunoprecipitated. DLAT and lipoylated DLAT levels are shown.    9 Supplementary Figure 6. ABHD11 loss does not alter PDHc activity.  (a-h) Stable isotope tracing in HeLa cells compared to mixed CRISPR KO populations (sgRNA) of ABHD11, OGDH or pyruvate dehydrogenase E1 alpha subunit (PDHA1) incubated with [U-13C6]-glucose. Isotopologues of pyruvate (b), and phosphoenolpyruvate (PEP) (c) confirm that PDHA1 loss impaired PDHc function, resulting in pyruvate and PEP accumulation. Isotopologues of 2-OG (d) and malate (e) confirm that ABHD11 and OGDH loss impairs the TCA cycle by decreased OGDHc activity, within increased 2-OG and decreased malate. Serine (f) and aspartate (g) increases following PDHA1 loss are consistent with decreased PDHc  10 function. ABHD11 and OGDH loss do not increase serine or aspartate pools (f, g). (h) Lactate levels are increased with PDHA1 loss but not with ABHD11 or OGDH depletion. Two biologically independent samples are shown; n=5 technical replicates per sample, mean ± SD. The m+0 to m+5 isotopologues are indicated.       11 Supplementary Figure 7. ABHD11 prevents the formation of lipoyl adducts on the OGDHc    (a) Schematic of lipoic acid synthesis and conjugation pathway. Mitochondrial fatty acid synthesis provides the octanoylated (Oc) precursor for lipoic acid synthesis. MECR is upstream of octanoylated ACP, converting Trans-2-enoyl-ACP to acyl-ACP. LIPT2 catalyses the transfer of octanoate to GCSH. LIAS converts octanoate to lipoate. LIPT1 is thought to be the major lipoyl transferase allowing conjugation to conserved lysine residues in 2-oxoacid dehydrogenase subunits such as DLAT and DLST. (b) Depletion of lipoic acid synthesis and conjugation components in HeLa cells. Mixed HeLa KO populations of MECR, LIPT2, LIPT1, LIAS and ABHD11 were generated and immunoblotted for lipoylated proteins. b-actin served as a loading control.      12 Supplementary Figure 8. The effect of ABHD11 depletion or inhibition on cell growth and mitochondrial ROS.  (a) ML226 treatment does not alter cell growth. HeLa cells were treated with 1µM ML226 or a DMSO control, and cell growth monitored over 4 days (n=3 biologically independent samples, mean ± SD). (b) LC-MS quantification of glutathione (GSH) isotopologues from [U-13C5] glutamine treated control HeLa cells compared to mixed CRISPR KO populations  13 (sgRNA) of ABHD11 or OGDH (two biologically independent samples; n=5 technical replicates per sample, mean ± SD). (c, d) Mitochondrial ROS levels following OGDH, LIAS, PHD2 or ABHD11 depletion. HeLa Cas9 cells were transduced with sgRNA targeting OGDH, LIAS, PHD2 (c) or ABHD11 (d). After 10-13 days cells were stained with MitoSOX Red, and fluorescence measured by flow cytometry. Treatment with Antimycin A (10 µM, 30 min 37 °C) was used as a positive control for mitochondrial ROS. Example of gating strategy is shown in Supplementary Figure 10b. (e) HRE-GFPODD reporter levels following treatment with Antimycin A (10µM) for 30 min at 37°C showed no change in GFP fluorescence compared to control cells treated with DMSO.   14 Supplementary Figure 9. ABHD11 prevents the formation of lipoyl adducts on the OGDHc  (a) Effect of N-ethyl maleimide (NEM) treatment on protein lipoylation detected by immunoblot. Control or ABHD11 deficient HeLa cells were lysed in a HEPES buffer, and free thiols in HeLa cells were blocked with the addition of 10mM NEM (4°C, 1 hour). Immunoblot of lipoylated proteins confirmed efficient blocking of free thiols. (b) Representative chromatograms of DLST peptide encoding the lipoylated region from HeLa cells, demonstrating that the m/z separation of the differently modified DLST peptide (DK*TSVQVPSPA). (c) Overexpression of ABHD11 catalytic inactive mutants renders cells more susceptible to lipoyl adduct formation. HeLa cells expressing ABHD11-GFP, ABHD11 S141A-GFP, ABHD11 H296A-GFP or a GFP only lentivirus (pSFFV-GFP) were treated with 4-HNE at the concentrations indicated, and lipoylation levels measured using the anti-lipoate antibody. Loss of lipoylation represents lipoyl adduct formation.   15 Supplementary Figure 10. Flow cytometry gating    (a, b) Example of gating strategy from control samples of Figure 1d (a) and Supplementary Figure 8d (b). Cells are gated on forward scatter (FSc) and side scatter (SSc) to exclude cell fragments; no other gating or exclusion of data was performed. The percentage of live cells included in the subsequent analysis is displayed.   16 Supplementary Figure 11. Uncropped original scans      17  18  19  20  21  22  23      24 Supplementary Table 1 Gene symbol Protein name Peptide count Control ABHD11-HA  WT S141A H296A ABHD11 ABHD11  1 666 500 308 HSPA9 Stress-70 protein 16 34 32 41 HSPD1 60 kDa heat shock protein 12 33 18 37 LRPPRC Leucine-rich PPR motif-containing protein 24 17 12 8 NME4 Nucleoside diphosphate kinase 18 19 13 13 ATP5A1 ATP synthase subunit alpha 8 12 7 5 ATP5B ATP synthase subunit beta 9 13 7 5 SSBP1 Single-stranded DNA-binding protein 7 14 6 3 MRPS27 28S ribosomal protein S27 13 6 5 4 TFAM Transcription factor A 8 4 4 5 GCDH Glutaryl-CoA dehydrogenase 11 6 4 6 MRPS34 28S ribosomal protein S34 7 5 8 2 CPS1 Carbamoyl-phosphate synthase 1 8 2 10 ACAD9 Acyl-CoA dehydrogenase family member 9 7 5 4 6 SLC25A3 Phosphate carrier protein 5 5 2 5 TUFM Elongation factor Tu 3 8 3 2 PGAM5 Serine/threonine-protein phosphatase PGAM5, mitochondrial 3 4 5 5 SHMT2 Serine hydroxymethyltransferase 1 7 1 3 SLC25A1 Tricarboxylate transport protein 5 2 2 4 DLST Dihydrolipoyllysine-residue succinyltransferase  1 4 2 2 DLAT Dihydrolipoyllysine-residue acetyltransferase  1 3 3 1 OGDH 2-oxoglutarate dehydrogenase 0 3 2 4  Top mitochondrial proteins identified with immunoprecipitation-LC-MS using ABHD11-HA overexpressed in HeLa cells. The number of confidently (>90%) assigned unique peptides identified in each sample by Scaffold (Proteome Software, Inc) is displayed on the right, for each protein in each sample. The gene symbol and name of the top 23 proteins (out of 53), ordered by total peptide count, is displayed.    25 Supplementary Table 2 Reagents and Antibodies  Source Identifier Antibodies Rabbit polyclonal anti-5hmC Dot blot: 1:10,000 Active Motif Cat#39770; RRID: AB_10013602 Lot 2158003 Rabbit polyclonal anti-ABHD11 Immunoblot: 1:2000 Signalway Cat#34366 Lot 4813 Mouse monoclonal anti-β actin Immunoblot: 1:20,000 Sigma Cat#A2228; RRID: AB_476697 Lot 112M4762V Mouse monoclonal anti-Cytochrome C Immunoblot: 1:5000 Abcam Cat#ab110325; RRID: AB_10864775 Clone 37BA11 Rabbit polyclonal anti-DLD Immunoblot: 1:2000 GeneTex  Cat#GTX101245; RRID: AB_1240715 Lot 39506 Mouse monoclonal anti-DLAT Immunoblot: 1:2000 Cell Signalling Cat#12362S; RRID: AB_2797893 Clone 4A4-B6-C10 Lot 1 Mouse monoclonal anti-DLST (used for IP) Abcam Cat#ab110306; RRID: AB_10862702 Clone 9F4BD5 Lot 3278422-1 Rabbit monoclonal anti-DLST (used for immunoblot) Immunoblot: 1:2000 Cell Signalling Cat#11954; RRID: AB_2732907 Clone D22B1 Mouse monoclonal anti-GFP Immunoblot: 1:2000 Roche Cat#11814460001; RRID: AB_390913 Clones 7.1 & 13.1 Rabbit monoclonal anti-H3 Immunoblot: 1:2000 Cell Signalling Cat#4499; RRID: AB_10544537 Clone D1H2 Rabbit monoclonal anti-H3K4me3 Immunoblot: 1:1000 Cell Signalling Cat#9751; RRID: AB_2616028 Clone C42D8 Rabbit monoclonal anti-H3K9me3 Immunoblot: 1:1000 Cell Signalling Cat# 13969; RRID: AB_2798355 Clone D4W1U Rat monoclonal anti-HA Immunoblot: 1:2000  Roche Cat#11867423001; RRID: AB_390918 Clone 3D10 Mouse monoclonal anti-HIF-1⍺	Immunoblot: 1:1000 BD Biosciences Cat#610959; RRID: AB_398272 Lot 9049717 Rabbit monoclonal anti-Hydroxy-HIF-1⍺	Immunoblot: 1:1000 Cell Signalling Cat#3434; RRID: RRID:AB_2116958 Clone D43B5 Lot 6  26 Rabbit polyclonal anti-Lipoic acid Immunoblot: 1:2000 Calbiochem Cat#437695; RRID: AB_212120 Lot 3308897 Rabbit polyclonal anti-MECR Immunoblot: 1:1000 Proteintech Cat#51027-2-AP; RRID: AB_615013 Lot 1537 Mouse monoclonal anti-MFN2 Immunoblot: 1:1000 Abcam Cat#ab56889; RRID: AB_2142629 Clone 6A8 Mouse monoclonal anti-NDUFB8 Immunoblot: 1:2500 Abcam Cat#ab110242; RRID: AB_10859122 Clone 20E9DH10C12 Rabbit polyclonal anti-OGDH Immunoblot: 1:1000 Immunofluorescence microscopy: 1:100 Atlas Antibodies Cat#HPA020347; RRID: AB_1854773 Lot A74004 Rabbit polyclonal anti-PHD2 (EGLN1) Immunoblot: 1:2000 Novus Cat#NB100-137; RRID: AB_10003054 Lot A3 Alexa-Fluor 647 Goat Anti-Rabbit IgG Microscopy secondary: 1:1000 Thermo Cat#A21245; RRID:AB_2535813 Lot 1558736 Peroxidase-AffiniPure Goat Anti-Mouse IgG Immunoblot secondary: 1:20,000 Jackson Cat#115-035-146; RRID:AB_2307392 Peroxidase-AffiniPure Goat Anti-Rabbit IgG Immunoblot secondary: 1:20,000 Jackson Cat#111-035-045; RRID: AB_2337938 Peroxidase-AffiniPure Goat Anti-Rat IgG Immunoblot secondary: 1:20,000 Jackson Cat#112-035-167; RRID: AB_2338139 Reagents Antimycin A Alfa Aesar Cat#J63522; CAS: 1397-94-0s Dimethyloxalylglycine Cayman Chemical Cat#71210; CAS: 89464-63-1 FCCP Cayman Chemical Cat#15218; CAS: 370-86-5 Sodium oxamate Sigma Cat# O2751; CAS: 565-73-1   GSK-2837808A Tocris CAS: 1445879-21-9 ML226 Cayman Chemical Cat#25681; CAS: 2055172-43-3 Oligomycin A Cayman Chemical Cat#11342; CAS: 579-13-5 Rotenone Sigma Cat#R8875; CAS: 83-79-4 VH298 A gift from Alessio Ciulli  MitoSOX Red ThermoFisher Scientific Cat#M36008 3xFLAG Peptide Sigma Cat#F4799 His-HIF-1⍺ODD (aa530-652) Burr et al, 2016    27 Supplementary Table 3  CRISPR sgRNA oligonucleotide sequences ABHD11 sgRNA 1 TGCTGTAGATATCAGCCCAG ABHD11 sgRNA 2 AAGATCTTGGCCCAGCAGAC ABHD11 sgRNA 3 GCTGTGGCCAACGACGACGC ABHD11 sgRNA 4 GCAGAAGGTCCTGCAGGTCC LIAS sgRNA 1 TTAGGTTAAGACTACCTCCA LIPT1 sgRNA 1 ATGCCTACCAATTACAACAG LIPT1 sgRNA 2 GTAGCCTGCACATCCAGCTG LIPT2 sgRNA 1 CAGGCGCACCAACCGAACGG LIPT2 sgRNA 2 TATACGGCCGGGCTGCGCGG MECR sgRNA 1 GCAGGGATTGACACCCAGGG MECR sgRNA 2 GAAGTCCATCAACATCCTGT OGDH sgRNA 1 CTGCTCTTACCTCCAGCCGA OGDH sgRNA 2 TTCCTGTCCCCCGATGAAAG PDHA1 sgRNA 1 GATGCAGACTGTACGCCGAA PDHA1 sgRNA 2 AGGATGGGCTCAAATACTAC PHD2 sgRNA 1 ATGCCGTGCTTGTTCATGCA VHL sgRNA 1 GTGCCATCTCTCAATGTTGA  Custom screen primers (TKO) TKO Inner PCR forward AATGATACGGCGACCACCGAGATCTACA CTCTCTTGTGGAAAGGACGAGGTACCG TKO custom sequencing primer ACACTCTCTTGTGGAAAGGACGAGGTACCG  NEBuilder HiFi PCR primers to clone ABHD11 into pHRSIN lentiviral vector Forward CAGTCCTCCGACAGACTGAGTCGCCCGGGGG GGATCCGCCACCATGcgagccggccaacagcttgcaa Reverse CTTGCATGCCTGCAGGTCGACTCTAGAGTCGC GGCCGCttagaccaggaagcctcggatggcagc  NEBuilder HiFi PCR primer to clone ABHD11 with C-terminal GFP tag into pHRSIN lentiviral vector Reverse (for ABHD11) CTTGCTCACgaccaggaagcctcggatggc Forward (GFP) gcttcctggtcGTGAGCAAGGGCGAGGAGCTG Reverse (GFP) GTCGACTCTAGAGTCGCGGCCGCttaCTTGTA CAGCTCGTCCATGCCGAG  NEBuilder HiFi PCR primer to clone ABHD11 with C-terminal HA tag Reverse GTCGACTCTAGAGTCGCGGCCGCttaCT TGTACAGCTCGTCCATGCCGAG   NEBuilder HiFi PCR primers to create silent mutations in ABHD11 sgRNA site 2 (mutations capitalised) Forward caaAatACtCgcAcaAcaAacaggccgtagggtg Reverse gtTtgTtgTgcGaGTatTttggcgatggagttgaagttag   28 NEBuilder HiFi PCR primers to create S141A active site mutation in ABHD11 Forward cacGCGatgggaggaaagacag Reverse catCGCgtggccaacgacgac  NEBuilder HiFi PCR primers to create H296A active site mutation in ABHD11 Forward ccgaacgctggcGCc Reverse cagcgtggatccagGCg  Gibson Assembly PCR primers to clone ABHD11 into pCEFL 3xFLAG mCherry vector Forward GGAATTGGCGAAGCTTGGTACCGAGCTCGG ATCCGCCACCATGcgagccggccaacagcttgcaa Reverse CCGTCATGGTCTTTGTAGTCAGCCCGCTCG AGCGGCCGCCCgaccaggaagcctcggatggcagc  QPCR primers GAPDH Forward  ATGGGGAAGGTGAAGGTCG GAPDH Reverse CTCCACGACGTACTCAGCG CAIX Forward GCCGCCTTTCTGGAGGA CAIX Reverse TCTTCCAAGCGAGACAGCAA VEGF Forward TACCTCCACCATGCCAAGTG VEGF Reverse ATGATTCTGCCCTCCTCCTTC List of sgRNA sequences used, and PCR primers used for genome-wide screen amplification and sequencing, and cloning of ABHD11 expression vectors.   

ABHD11 maintains 2-oxoglutarate metabolism by preserving functional lipoylation of the 2-oxoglutarate dehydrogenase complex

2-oxoglutarate (2-OG or α-ketoglutarate) relates mitochondrial metabolism to cell function by modulating the activity of 2-OG dependent dioxygenases involved in the hypoxia response and DNA/histone modifications. However, metabolic pathways that regulate these oxygen and 2-OG sensitive enzymes remain poorly understood. Here, using CRISPR Cas9 genome-wide mutagenesis to screen for genetic determinants of 2-OG levels, we uncover a redox sensitive mitochondrial lipoylation pathway, dependent on the mitochondrial hydrolase ABHD11, that signals changes in mitochondrial 2-OG metabolism to 2-OG dependent dioxygenase function. ABHD11 loss or inhibition drives a rapid increase in 2-OG levels by impairing lipoylation of the 2-OG dehydrogenase complex (OGDHc)-the rate limiting step for mitochondrial 2-OG metabolism. Rather than facilitating lipoate conjugation, ABHD11 associates with the OGDHc and maintains catalytic activity of lipoyl domain by preventing the formation of lipoyl adducts, highlighting ABHD11 as a regulator of functional lipoylation and 2-OG metabolism.Wellcome Trust
Medical Research Council
Lister Institut

Bailey, Peter SJ

Ortmann, Brian M

Martinelli, Anthony W

Houghton, Jack W

Costa, Ana SH

Burr, Stephen P

Nathan, James A

English

ABHD11 maintains 2-oxoglutarate metabolism by preserving functional lipoylation of the 2-oxoglutarate dehydrogenase complex.

2-oxoglutarate links mitochondrial metabolism to oxygen sensing, gene transcription and epigenetic modifications. Here, the authors describe a mutagenesis screen to find genes that control 2-oxoglutarate levels, and identify ABHD11 as a mitochondrial regulator of 2-oxoglutarate abundance

Peter S. J. Bailey

Brian M. Ortmann

Anthony W. Martinelli

Jack W. Houghton

Ana S. H. Costa

Stephen P. Burr

Robin Antrobus

Christian Frezza

James A. Nathan

Directory of Open Access Journals

2-oxoglutarate (2-OG or -ketoglutarate) relates mitochondrial metabolism to cell function by modulating the activity of 2-OG dependent dioxygenases involved in the hypoxia response and DNA/histone modifications. However, metabolic pathways that regulate these oxygen and 2-OG sensitive enzymes remain poorly understood. Here, using CRISPR Cas9 genome-wide mutagenesis to screen for genetic determinants of 2-OG levels, we uncover a redox sensitive mitochondrial lipoylation pathway, dependent on the mitochondrial hydrolase ABHD11, that signals changes in mitochondrial 2-OG metabolism to 2-OG dependent dioxygenase function. ABHD11 loss or inhibition drives a rapid increase in 2-OG levels by impairing lipoylation of the 2-OG dehydrogenase complex (OGDHc) – the rate limiting step for mitochondrial 2-OG metabolism. Rather than facilitating lipoate conjugation, ABHD11 associates with the OGDHc and maintains catalytic activity of lipoyl domain by preventing the formation of lipoyl adducts, highlighting ABHD11 as a regulator of functional lipoylation and 2-OG metabolism.Wellcome Trust
Medical Research Council
Lister Institut

Bailey, Peter

Ortmann, brian

Martinelli, Anthony

Houghton, Jack

Costa, Ana

Burr, Stephen

Nathan, James

https://www.repository.cam.ac.uk/bitstream/handle/1810/309356/s41467-020-17862-6.pdf?sequence=4&isAllowed=y

ABHD11 maintains 2-oxoglutarate metabolism by preserving functional lipoylation of the 2-oxoglutarate dehydrogenase complex

Abstract

Similar works

Full text

Available Versions

Apollo (Cambridge)

Apollo (Cambridge)

Directory of Open Access Journals

Apollo (Cambridge)

Apollo (Cambridge)