biosensor based on Single Walled Carbon Nanotube (SWNT)-Poly (GT)n ssDNA hybrid has been developed for medical diagnostics. The absorption spectrum of this assay is determined with the help of a Shimadzu UV-VIS-NIR spectrophotometer. Two
distinct bands each containing three peaks corresponding to first and second van Hove singularities in the density of states of the nanotubes were observed in the absorption spectrum. When a single-stranded DNA (ssDNA) having a sequence
complementary to probic DNA is added to the ssDNA-SWNT conjugates, hybridization takes place, which causes the red shift of absorption spectrum of nanotubes. On the
other hand, when the DNA is noncomplementary, no shift in the absorption spectrum occurs since hybridization between the DNA and probe does not take place. The red shifting of the spectrum is considered to be due to change in the dielectric
environment around nanotubes.
When you are citing the document, use the following link http://essuir.sumdu.edu.ua/handle/123456789/2212

Aneja, A.

Bansal, J.

Bhatnagar, P.K.

Mathur, N.

Mathur, P.C.

Singh, I.

SocioEconomic Challenges Journal (Sumy State University)

 
 
 
J. Nano- Electron. Phys. 
3 (2011) No1, P. 776-782 
Ó 2011 SumDU 
(Sumy State University) 
 
 
776 
PACS numbers: 87.14.gk, 61.48.De 
 
A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION USING 
ABSORPTION SPECTRA OF SWNT-DNA COMPOSITE 
 
J. Bansal, I. Singh, N. Mathur, A. Aneja, P.K. Bhatnagar, P.C. Mathur 
 
 University of Delhi South Campus, 
Benito Juarez Road, New Delhi-21, INDIA 
 E-mail: jyoti_2681986@yahoo.com 
 
A biosensor based on Single Walled Carbon Nanotube (SWNT)-Poly (GT)n   ssDNA 
hybrid has been developed for medical diagnostics. The absorption spectrum of this 
assay is determined with the help of a Shimadzu UV-VIS-NIR spectrophotometer. Two 
distinct bands each containing three peaks corresponding to first and second van 
Hove singularities in the density of states of the nanotubes were observed in the 
absorption spectrum. When a single-stranded DNA (ssDNA) having a sequence 
complementary to probic DNA is added to the ssDNA-SWNT conjugates, hybridization 
takes place, which causes the red shift of absorption spectrum of nanotubes. On the 
other hand, when the DNA is noncomplementary, no shift in the absorption spectrum 
occurs since hybridization between the DNA and probe does not take place. The red 
shifting of the spectrum is considered to be due to change in the dielectric 
environment around nanotubes. 
 
Keywords: BIOSENSOR, DNA, SWNT, ABSORPTION, EXCITON BINDING 
ENERGY, CHIRALITY. 
 
(Received 04 February 2011, in final form 14 October 2011) 
 
1. INTRODUCTION 
 
Medical Diagnostics based on DNA sequence detection has recently become 
very popular because it is a low cost, fast and reliable technique requiring a 
very  small  amount  of  DNA  without  requiring  polymerase  chain  reaction  
(PCR). The basic principle of DNA sequence detection is that the ssDNA to be 
tested must first be immobilized on a suitable target with the help of chemical 
adsorption [1, 2], covalent bonding [3], electrostatic attraction [4, 5] or co-
polymerization [6, 7] and the immobilized ssDNA must produce a signal, 
capable of being detected and analyzed. This signal should change 
significantly when ssDNA to be tested is hybridized with a complementary 
ssDNA. The testing method should be such that extensive sample 
pretreatment and derivatization are not needed; that is the quantity of sample 
required for testing is ultra low (~ 10–8 - 10–7 moles) so that the detection 
method is robust and inexpensive. Also, the sensor should be portable and of 
small dimensions. However, the most important feature of a DNA sensor is its 
ability to discriminate between complementary (cDNA) and non-
complementary  DNA  (nDNA)  samples.  The  most  commonly  used  analytical  
signals for DNA hybridization are electrochemical [8] and piezoelectric [9]. 
Optical detection, particularly based on absorption from solution-based system 
is advantageous due to high sensitivity and selectivity. 
In the present work, we have developed a simple technique for DNA 
sequence detection using optical absorption properties of single walled carbon 
 
 
 
 A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 777 
nanotubes (SWNTs). The optical absorption in SWNTs is dominated by the 
transitions between van Hove singularities located symmetrically on the 
opposite sides of the Fermi level. The absorption spectrum of semiconducting 
SWNTs is in the near infrared (NIR) region and therefore this biosensor can 
be conveniently used in biological systems because absorption of blood and 
tissues  in  NIR  region  is  very  low.  Yet,  other  advantages  of  SWNTs  based  
biosensors are that labeling of DNA strands with dyes is not required as is the 
case with Fluorescence resonance energy transfer (FRET) based 
biosensors [10,11]. Besides this the SWNTs are resistant to photo bleaching 
and  can  therefore  have  a  higher  operating  life  as  compared  to  other  
biosensors.  The  main  obstacle  in  using  SWNTs  in  biosensors  [12]  and  
nanoprobes  [13]  is  their  poor  solubility  in  any  organic  or  aqueous  solvent.  
Further, their properties are strongly dominated by their physical 
characteristics such as diameter, length and most importantly chirality (n, m). 
The interaction mechanism of DNA-SWNT hybrid is the following: Both 
SWNT and ssDNA are hydrophobic in nature (only one surface of ssDNA is 
hydrophobic while the other surface is hydrophilic [14]). As a result of their 
hydrophobic nature, the ssDNA segment is very quickly adsorbed and 
wrapped (on a time scale of few hundred pico seconds) [14] on the SWNT 
surface, which is individually dispersed by the adsorbing DNA molecules. 
However, it is known that only ssDNA sequences of repeats of alternating G 
and T i.e. poly (GT)n with n ³ 10 can efficiently disperse SWNTs [15]. 
The principle of DNA –SWNT sensor is the following: A ssDNA (probic 
DNA) is tagged to the poly (GT)n  sequence and the resulting DNA sequence 
i.e. poly (GT)n –probic DNA is used to disperse SWNTs in the aqueous 
solution. The probic DNA binds itself non-covalently to the surface of SWNTs 
through p stacking [16]. As the experimental ssDNA (having sequence 
complementary to  that  of  probic  DNA – cDNA) is  added to  this  solution,  it  
hybridizes itself with the probic DNA. The hybridization of cDNA results in a 
decrease of surface area of SWNTs exposed to the aqueous dispersing medium 
and hence decreases the effective dielectric constant of the SWNT 
environment. The exciton binding energy of SWNTs is very sensitive to the 
dielectric constant of the ambient in which SWNTs are kept. The exciton 
binding energy increases with the decrease in the dielectric constant of the 
local environment [17] due to increase of electrostatic interaction between 
quantum mechanically confined electrons and holes. This results in decrease 
in optical band gap (Eii) of SWNTs due to which absorption peaks of SWNTs 
get red shifted in accordance with the relation [18], 
 
 Eii = Eiigr + Eiiee – Eiieh 
 
where Eiigr is the self-energy of an electron due to the repulsive interaction 
between electrons; Eiiee  represents the energy of repulsive interaction 
between electrons; and Eiieh denotes the binding energy of an exciton. 
We have utilized this change in optical transition energy due to DNA 
wrapping in determining a known DNA sequence corresponding to antigen 
Escherichia  coli.  We  have  studied  the  absorption  spectrum  of  SWNTs  by  
dispersing  them  with  probic  DNA  in  the  presence  of  cDNA  and  nDNA  
separately. Using SWNT of different chiralities we have found that the red 
shifting of the absorption peaks is highly sensitive to the chirality of the 
SWNT sample. 
 
 
 
778 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  
2. MATERIALS AND METHODS  
 
The  as  grown  SWNT  samples  and  ssDNA  primers  were  commercially  
procured from Sigma Aldrich, USA. The procured SWNT samples have 
diameter ranging from 0.7 nm to 1.2 nm and length upto 20 mm. The 
sequences of procured ssDNA samples are as shown in table 1. 
 
Table 1 – Oligonucleotides used in the experiment 
 
S. No. Sample Sequence 
1 
ssDNA 
probe 
5’-(GT)15–(GTAAATGGTGTTAGGGTTGC)-3’  (50 
mer) 
2 cDNA 5’-(GCAACCCTAACACCATTTAC)-3’   (20 mer) 
3 nDNA 5’-(CGTTGGGATTGTGGTAAATG)-3’   (20 mer) 
 
For preparing ssDNA-SWNT hybrid, an aqueous solution containing probic 
ssDNA with concentration 1 mg/ml was prepared in TRIS buffer (pH 7.4). To 
this solution, SWNTs were added keeping their concentration as 1 mg/ml and 
the resultant solution was ultrasonicated for about 2 hrs. to obtain a 
homogeneous  suspension  of  SWNTs  in  the  solution.  This  solution  was  then  
centrifuged for 2 hrs at 15,000 g in a microcentrifuge to remove 
nondispersible SWNTs and other accompanying impurities. The UV-VIS-NIR 
absorption spectrum of this solution was studied using Shimadzu 
Spectrophotometer Model Solid Spec 3700. To this solution, cDNA and nDNA 
primers were added separately and their effect on the absorption spectrum of 
the  SWNTs  was  studied  after  annealing  the  solutions  at  50 °C for about 
30 min. The annealing improves hybridization of DNA and the temperature 
and duration of annealing were optimized after many trials and errors.  
  
3. RESULTS & DISCUSSION 
 
The absorption spectrum of the SWNTs dispersed in poly (GT)n probic 
ssDNA primer solution is shown in Fig. 1. We have used this absorption 
spectrum to determine the band gap energies between van Hove singularities 
of the nanotubes present in the given sample. Two dominant sets of three 
peaks corresponding to the transitions between first (l11) and second (l22) 
van Hove singularities are observed in the spectrum. The first set of peaks 
corresponding to first valance band level (V1) and first conduction band level 
(C1) transitions are observed at 976, 1178 and 1388 nm. Another three 
peaks corresponding to second-order valence band level (V2) and second order 
conduction band level (C2) transitions are observed at 540, 570 and 800 nm. 
The three V1-C1 and V2-C2 peaks correspond to three different 
semiconducting nanotubes having different diameters in the solution. 
To determine the chiralities and diameters of these semiconducting 
nanotubes, we have used the experimental data on optical transitions studied 
by Weisman and Bachilo [19] on 33 semiconducting SWNT samples having 
different diameters and chiralities. Using the experimental values and data 
of Weisman and Bachilo for l11 and l22,  we  have  obtained  the  value  of  
diameter and chirality of our samples which are shown in Table 2. 
 The  effect  of  hybridization  of  cDNA  on  the  probic  DNA  is  shown  in  
Fig. 2. A red shift of 20 nm in absorption peak of (10, 0) tube is observed 
from 1178 to 1198 nm). The reason for this red shift is attributed to the 
 
 
 
 A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 779 
 
 
Fig. 1 – Absorption spectrum of SWNTs dispersed in poly (GT)n –  probic  DNA  
aqueous solution 
 
Table 2 – Estimation of diameter and chirality of nanotubes corresponding 
to observed absorption peaks using absorption spectrum 
 
S. 
No. 
l11 
(nm) 
l22 
(nm) 
Diameter 
(nm) 
Chirality 
(n,m) 
Chiral Angle 
q = tan-1 (Ö3 
m/(2n + u) 
Type(2n+m) 
mod3 
1 976 570 0.757 (6,5) 26 II 
2 1178 540 0.794 (10,0) 0 II 
3 1388 800 1.170 (9,8) 28 II 
 
denser coverage of SWNT surface by DNA oligonucleotides. Due to DNA 
hybridization on the surface of nanotubes, the surface gets more covered and 
its contact with water gets reduced. This results in decrease in dielectric 
constant of the local environment of SWNTs, which increases the exciton 
binding energy in SWNTs due to enhancement of coloumbic interactions. The 
increase in exciton binding energy is the main cause of red shifting of 
absorption peak of (10, 0) nanotube. Therefore, this shift in absorption can be 
considered as a measure to analyze DNA hybridization on the SWNT surface. 
 
 
 
Fig. 2 – Absorption spectra of probic DNA-SWNT hybrid with and without cDNA 
 
 
 
780 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  
We have also studied the effect of addition of nDNA on the absorption 
spectrum of SWNTs (fig. 3). In this case a negligible red shift of 2 nm is 
observed in the absorption peak of (10, 0) nanotube. Therefore, this DNA-
SWNT hybrid system can be effectively used to detect any particular DNA 
sequence. 
 
 
 
Fig. 3 – Absorption spectra of probic DNA-SWNT hybrid with and without nDNA 
 
It is further observed that the effect of cDNA hybridization on SWNT 
surface is not the same for all the three observed nanotubes. While for 
(10, 0) tube a red shift of 20 nm is observed, the shift reduces to 4 nm for 
(6, 5) nanotube and for (9, 8) tube very minor shift of 1 nm is observed (as 
shown in table 3). This discrepancy in the red shifting of absorption peaks is 
due to the different conformation of SWNTs [20]. The exciton binding 
energy of SWNTs is strongly dominated by the effective mass, which in turn 
is a function of chirality of the nanotubes. 
 
Table 3 – Shifting of first order absorption peaks of SWNTs due to cDNA 
hybridization 
 
S.No. 
Before 
Hybridization 
After 
Hybridization 
DE11 =  
E11 – E'11 
(eV) 
Chirality 
(n, m) 
Angle 
(q°) 
Diamet
er (nm) 
 l11 
(nm) 
E11 
(eV) 
l'11 
(nm) 
E'11 
(eV) 
    
1 976 1.27 980 1.2653 0.0047 (6,5) 26 0.757 
2 1178 1.052 1198 1.035 0.017 (10,0) 0 0.794 
3 1388 0.8933 1389 0.8927 0.0005 (9,8) 28 1.17 
 
The cDNA hybridization also results in shifting of second order 
absorption  peaks  of  SWNTs.  The  shifting  pattern  of  l22 peaks  is  quite  
interesting.  While  for  (6,  5)  and  (9,  8)  nanotubes  a  red  shift  of  2  nm  is  
observed, for (10, 0) nanotube a blue shift of 6nm is observed as shown in 
 
 
 
 A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 781 
Table 4. The observed behavior of peak shifting can be related to the chiral 
angles of the nanotubes. Ohno et al. [20] have studied the effect of chirality 
& diameter of the nanotubes on the change in optical band gap E11 and E22 
(corresponding to l11 and l22) due to change in dielectric constant of local 
environment of the SWNTs for type I and type II SWNTs separately. They 
have found that for family I SWNTs that DE11 increases with increasing 
chiral angles while for family II SWNTs the trend is opposite i.e. DE11 
decreases with increasing chiral angles. It is further shown by these authors 
that for family II tubes for lower chiral angles (till ~ 15 °) E22 peaks gets 
blue shifted with decrease in dielectric constant and for higher angles a red 
shift of E22 peaks is observed. Our results (family II) are in agreement with 
Ohno et al. [20] results. In our case, for (10, 0) nanotube the chiral angle is 
0° and therefore a large shifting of 20nm is observed in E11 peak while for 
other two tubes the estimated chiral angles are 26° and 28° that’s  why  a  
lesser peak shift is observed. Further, for E22 peaks, the absorption peak of 
(10, 0) tube (chiral angle 0°)  gets  blue  shifted  by  6  nm  and  for  other  two  
tubes (26° and 28° angle) peaks are red shifted (Table 4).  
 
Table 4 – Shifting of second order absorption peaks of SWNTs due to cDNA 
hybridization 
 
S.No. Before 
Hybridization 
After 
Hybridization 
DE22 =  
E22 – E'22 
(eV) 
Chirality 
(n, m) 
Angle 
(q°) 
Diamet
er (nm) 
 l22 
(nm) 
E22 
(eV) 
l'22 
(nm) 
E'22 
(eV) 
    
1 570 2.1754 572 2.1678 0.0076 (6, 5) 26 0.757 
2 540 2.296 534 2.322 -0.026 (10, 0) 0 0.794 
3 800 1.55 802 1.546 0.0097 (9, 8) 28 1.17 
 
A possible explanation for these observations was given by J. Jiang et 
al. [21]. These authors said that dependence of chiral angle on the exciton 
binding energy in SWNTs comes via an effective mass m* so that binding 
energy is proportional to (m*)a – 1 where a is an empirical parameter. 
 
4. CONCLUSION 
 
It is concluded that DNA-SWNT hybrid system can be used as an efficient 
bio-sensing probe to detect a known antigen. The sensitivity of the sensor is 
strongly dominated by the chirality of SWNTs. While the high chiral angled 
tubes do not give any significant signal for cDNA hybridization, the low 
chiral angled SWNTs have proved themselves a promising candidate for 
DNA sensing. 
 
REFERENCES 
1. P.W. Barone, S. Baik, D.A. Heller, M.S. Strano, Nat. Mater. 4, 86 (2005). 
2. A. Star, E. Tu, J. Niemann, J.C.P. Gabriel, C.S. Joiner, C. Valcke, PNAS 103(4), 
921 (2006). 
 
 
 
782 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  
3. H. Gao, Y. Kong, Annu. Rev. Mater. Res. 34, 123 (2004). 
4. S. Han, D. Ralin, J. Wang, X. Li, F. Zhou, Langmuir 19, 8943 (2003). 
5. J.M. Jaklevic, H.R. Garmer, G.A. Miller, Annu. Rev. Biomed. Eng. 01, 649 (1999). 
6. A.V. Vasiliskov, E.N. Timofeev, S.A. Surzhikov, A.L. Drobyshev, V.V. Shick, 
A.D. Mirzabekov, Biotechniques 27, 592 (1999). 
7. Hornes et al: Oligonucleotide linked magnetic Particles and uses thereof. US Patent 5, 
512, 439, 1996. 
8. J. Li, H.T. Ng, A. Cassell, W. Fan, H. Chen, Q. Ye, J. Koehne, J. Han, 
M. Meyyappan, Nano Lett. 3(5), 597 (2003). 
9. M. Minunni, S. Tombelli, E. Mariotti, M. Mascini, Fresenius J. Anal. Chem. 369, 
589 (2001). 
10. N. Mathur, A. Aneja, P.K. Bhatnagar, P.C. Mathur, J. of Sensors 2008, 1 (2008). 
11. A. Aneja, N. Mathur, P.K. Bhatnagar, P.C. Mathur, J. Biol. Phys. 34, 487 
(2008). 
12. H. Cai, X. Cao, Y. Jiang, P. He, Y. Fang, Anal. Bioanal. Chem. 375, 287 (2003). 
13. H.J. Dai, J.H. Hafner, A.G. Rinzler, D.T. Colbert, R.E. Smalley, Nature 384, 147 
(1996). 
14. X. Zhao, K. Johnson (http://puccini.che.pitt.edu/~karlj/Papers/DNA-SWNT.pdf). 
15. M. Zheng, A. Jagota, M.S. Strano, A.P. Santos, P. Barone, G. Chou, B.A. Diner, 
M.S. Dresselhaus, R.S. Mclean, G.B. Onoa, G.G. Samsonidze, E.D. Semke, 
M. Usrey, D.J. Walls, Science 302, 1545 (2003). 
16. M. Zheng, A. Jagota, E.D. Semke, B.A. Diner, R.S. Mclean, S.R. Lusting, 
R.E. Richardson, N.G. Tassi, Nat. Mater. 2, 338 (2003). 
17. E.S. Jeng, A.E. Moll, A.C. Roy, J.B. Gastala, M.S. Strano, Nano Lett. 6, 371 
(2006). 
18. Y. Ohno, S. Maruyama (http://www.intechopen.com/articles/show/title/). 
19. R.B. Weisman, S.M. Bachilo, Nano Lett. 3, 1235 (2003). 
20. Y. Ohno, S. Iwasaki, Y. Murakami, S. Kishimoto, S. Maruyama, T. Mizutani, 
Phys. Rev. B 73, 235427 (2006). 
21. J. Jiang, R. Saito, G.G. Samsonidze, A. Jorio, S.G. Chou, G. Dresselhaus, 
M.S. Dresselhaus, Phys. Rev. B 75, 035407 (2007). 


English

A nano-biosensor for DNA sequence detection using absorption spectra of SWNT-DNA composite

Electronic Sumy State University Institutional Repository

   J. Nano- Electron. Phys. 3 (2011) No1, P. 776-782 Ó 2011 SumDU (Sumy State University)   776 PACS numbers: 87.14.gk, 61.48.De  A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION USING ABSORPTION SPECTRA OF SWNT-DNA COMPOSITE  J. Bansal, I. Singh, N. Mathur, A. Aneja, P.K. Bhatnagar, P.C. Mathur   University of Delhi South Campus, Benito Juarez Road, New Delhi-21, INDIA  E-mail: jyoti_2681986@yahoo.com  A biosensor based on Single Walled Carbon Nanotube (SWNT)-Poly (GT)n   ssDNA hybrid has been developed for medical diagnostics. The absorption spectrum of this assay is determined with the help of a Shimadzu UV-VIS-NIR spectrophotometer. Two distinct bands each containing three peaks corresponding to first and second van Hove singularities in the density of states of the nanotubes were observed in the absorption spectrum. When a single-stranded DNA (ssDNA) having a sequence complementary to probic DNA is added to the ssDNA-SWNT conjugates, hybridization takes place, which causes the red shift of absorption spectrum of nanotubes. On the other hand, when the DNA is noncomplementary, no shift in the absorption spectrum occurs since hybridization between the DNA and probe does not take place. The red shifting of the spectrum is considered to be due to change in the dielectric environment around nanotubes.  Keywords: BIOSENSOR, DNA, SWNT, ABSORPTION, EXCITON BINDING ENERGY, CHIRALITY.  (Received 04 February 2011, in final form 14 October 2011)  1. INTRODUCTION  Medical Diagnostics based on DNA sequence detection has recently become very popular because it is a low cost, fast and reliable technique requiring a very  small  amount  of  DNA  without  requiring  polymerase  chain  reaction  (PCR). The basic principle of DNA sequence detection is that the ssDNA to be tested must first be immobilized on a suitable target with the help of chemical adsorption [1, 2], covalent bonding [3], electrostatic attraction [4, 5] or co-polymerization [6, 7] and the immobilized ssDNA must produce a signal, capable of being detected and analyzed. This signal should change significantly when ssDNA to be tested is hybridized with a complementary ssDNA. The testing method should be such that extensive sample pretreatment and derivatization are not needed; that is the quantity of sample required for testing is ultra low (~ 10–8 - 10–7 moles) so that the detection method is robust and inexpensive. Also, the sensor should be portable and of small dimensions. However, the most important feature of a DNA sensor is its ability to discriminate between complementary (cDNA) and non-complementary  DNA  (nDNA)  samples.  The  most  commonly  used  analytical  signals for DNA hybridization are electrochemical [8] and piezoelectric [9]. Optical detection, particularly based on absorption from solution-based system is advantageous due to high sensitivity and selectivity. In the present work, we have developed a simple technique for DNA sequence detection using optical absorption properties of single walled carbon     A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 777 nanotubes (SWNTs). The optical absorption in SWNTs is dominated by the transitions between van Hove singularities located symmetrically on the opposite sides of the Fermi level. The absorption spectrum of semiconducting SWNTs is in the near infrared (NIR) region and therefore this biosensor can be conveniently used in biological systems because absorption of blood and tissues  in  NIR  region  is  very  low.  Yet,  other  advantages  of  SWNTs  based  biosensors are that labeling of DNA strands with dyes is not required as is the case with Fluorescence resonance energy transfer (FRET) based biosensors [10,11]. Besides this the SWNTs are resistant to photo bleaching and  can  therefore  have  a  higher  operating  life  as  compared  to  other  biosensors.  The  main  obstacle  in  using  SWNTs  in  biosensors  [12]  and  nanoprobes  [13]  is  their  poor  solubility  in  any  organic  or  aqueous  solvent.  Further, their properties are strongly dominated by their physical characteristics such as diameter, length and most importantly chirality (n, m). The interaction mechanism of DNA-SWNT hybrid is the following: Both SWNT and ssDNA are hydrophobic in nature (only one surface of ssDNA is hydrophobic while the other surface is hydrophilic [14]). As a result of their hydrophobic nature, the ssDNA segment is very quickly adsorbed and wrapped (on a time scale of few hundred pico seconds) [14] on the SWNT surface, which is individually dispersed by the adsorbing DNA molecules. However, it is known that only ssDNA sequences of repeats of alternating G and T i.e. poly (GT)n with n ³ 10 can efficiently disperse SWNTs [15]. The principle of DNA –SWNT sensor is the following: A ssDNA (probic DNA) is tagged to the poly (GT)n  sequence and the resulting DNA sequence i.e. poly (GT)n –probic DNA is used to disperse SWNTs in the aqueous solution. The probic DNA binds itself non-covalently to the surface of SWNTs through p stacking [16]. As the experimental ssDNA (having sequence complementary to  that  of  probic  DNA – cDNA) is  added to  this  solution,  it  hybridizes itself with the probic DNA. The hybridization of cDNA results in a decrease of surface area of SWNTs exposed to the aqueous dispersing medium and hence decreases the effective dielectric constant of the SWNT environment. The exciton binding energy of SWNTs is very sensitive to the dielectric constant of the ambient in which SWNTs are kept. The exciton binding energy increases with the decrease in the dielectric constant of the local environment [17] due to increase of electrostatic interaction between quantum mechanically confined electrons and holes. This results in decrease in optical band gap (Eii) of SWNTs due to which absorption peaks of SWNTs get red shifted in accordance with the relation [18],   Eii = Eiigr + Eiiee – Eiieh  where Eiigr is the self-energy of an electron due to the repulsive interaction between electrons; Eiiee  represents the energy of repulsive interaction between electrons; and Eiieh denotes the binding energy of an exciton. We have utilized this change in optical transition energy due to DNA wrapping in determining a known DNA sequence corresponding to antigen Escherichia  coli.  We  have  studied  the  absorption  spectrum  of  SWNTs  by  dispersing  them  with  probic  DNA  in  the  presence  of  cDNA  and  nDNA  separately. Using SWNT of different chiralities we have found that the red shifting of the absorption peaks is highly sensitive to the chirality of the SWNT sample.    778 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  2. MATERIALS AND METHODS   The  as  grown  SWNT  samples  and  ssDNA  primers  were  commercially  procured from Sigma Aldrich, USA. The procured SWNT samples have diameter ranging from 0.7 nm to 1.2 nm and length upto 20 mm. The sequences of procured ssDNA samples are as shown in table 1.  Table 1 – Oligonucleotides used in the experiment  S. No. Sample Sequence 1 ssDNA probe 5’-(GT)15–(GTAAATGGTGTTAGGGTTGC)-3’  (50 mer) 2 cDNA 5’-(GCAACCCTAACACCATTTAC)-3’   (20 mer) 3 nDNA 5’-(CGTTGGGATTGTGGTAAATG)-3’   (20 mer)  For preparing ssDNA-SWNT hybrid, an aqueous solution containing probic ssDNA with concentration 1 mg/ml was prepared in TRIS buffer (pH 7.4). To this solution, SWNTs were added keeping their concentration as 1 mg/ml and the resultant solution was ultrasonicated for about 2 hrs. to obtain a homogeneous  suspension  of  SWNTs  in  the  solution.  This  solution  was  then  centrifuged for 2 hrs at 15,000 g in a microcentrifuge to remove nondispersible SWNTs and other accompanying impurities. The UV-VIS-NIR absorption spectrum of this solution was studied using Shimadzu Spectrophotometer Model Solid Spec 3700. To this solution, cDNA and nDNA primers were added separately and their effect on the absorption spectrum of the  SWNTs  was  studied  after  annealing  the  solutions  at  50 °C for about 30 min. The annealing improves hybridization of DNA and the temperature and duration of annealing were optimized after many trials and errors.    3. RESULTS & DISCUSSION  The absorption spectrum of the SWNTs dispersed in poly (GT)n probic ssDNA primer solution is shown in Fig. 1. We have used this absorption spectrum to determine the band gap energies between van Hove singularities of the nanotubes present in the given sample. Two dominant sets of three peaks corresponding to the transitions between first (l11) and second (l22) van Hove singularities are observed in the spectrum. The first set of peaks corresponding to first valance band level (V1) and first conduction band level (C1) transitions are observed at 976, 1178 and 1388 nm. Another three peaks corresponding to second-order valence band level (V2) and second order conduction band level (C2) transitions are observed at 540, 570 and 800 nm. The three V1-C1 and V2-C2 peaks correspond to three different semiconducting nanotubes having different diameters in the solution. To determine the chiralities and diameters of these semiconducting nanotubes, we have used the experimental data on optical transitions studied by Weisman and Bachilo [19] on 33 semiconducting SWNT samples having different diameters and chiralities. Using the experimental values and data of Weisman and Bachilo for l11 and l22,  we  have  obtained  the  value  of  diameter and chirality of our samples which are shown in Table 2.  The  effect  of  hybridization  of  cDNA  on  the  probic  DNA  is  shown  in  Fig. 2. A red shift of 20 nm in absorption peak of (10, 0) tube is observed from 1178 to 1198 nm). The reason for this red shift is attributed to the     A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 779   Fig. 1 – Absorption spectrum of SWNTs dispersed in poly (GT)n –  probic  DNA  aqueous solution  Table 2 – Estimation of diameter and chirality of nanotubes corresponding to observed absorption peaks using absorption spectrum  S. No. l11 (nm) l22 (nm) Diameter (nm) Chirality (n,m) Chiral Angle q = tan-1 (Ö3 m/(2n + u) Type(2n+m) mod3 1 976 570 0.757 (6,5) 26 II 2 1178 540 0.794 (10,0) 0 II 3 1388 800 1.170 (9,8) 28 II  denser coverage of SWNT surface by DNA oligonucleotides. Due to DNA hybridization on the surface of nanotubes, the surface gets more covered and its contact with water gets reduced. This results in decrease in dielectric constant of the local environment of SWNTs, which increases the exciton binding energy in SWNTs due to enhancement of coloumbic interactions. The increase in exciton binding energy is the main cause of red shifting of absorption peak of (10, 0) nanotube. Therefore, this shift in absorption can be considered as a measure to analyze DNA hybridization on the SWNT surface.    Fig. 2 – Absorption spectra of probic DNA-SWNT hybrid with and without cDNA    780 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  We have also studied the effect of addition of nDNA on the absorption spectrum of SWNTs (fig. 3). In this case a negligible red shift of 2 nm is observed in the absorption peak of (10, 0) nanotube. Therefore, this DNA-SWNT hybrid system can be effectively used to detect any particular DNA sequence.    Fig. 3 – Absorption spectra of probic DNA-SWNT hybrid with and without nDNA  It is further observed that the effect of cDNA hybridization on SWNT surface is not the same for all the three observed nanotubes. While for (10, 0) tube a red shift of 20 nm is observed, the shift reduces to 4 nm for (6, 5) nanotube and for (9, 8) tube very minor shift of 1 nm is observed (as shown in table 3). This discrepancy in the red shifting of absorption peaks is due to the different conformation of SWNTs [20]. The exciton binding energy of SWNTs is strongly dominated by the effective mass, which in turn is a function of chirality of the nanotubes.  Table 3 – Shifting of first order absorption peaks of SWNTs due to cDNA hybridization  S.No. Before Hybridization After Hybridization DE11 =  E11 – E'11 (eV) Chirality (n, m) Angle (q°) Diameter (nm)  l11 (nm) E11 (eV) l'11 (nm) E'11 (eV)     1 976 1.27 980 1.2653 0.0047 (6,5) 26 0.757 2 1178 1.052 1198 1.035 0.017 (10,0) 0 0.794 3 1388 0.8933 1389 0.8927 0.0005 (9,8) 28 1.17  The cDNA hybridization also results in shifting of second order absorption  peaks  of  SWNTs.  The  shifting  pattern  of  l22 peaks  is  quite  interesting.  While  for  (6,  5)  and  (9,  8)  nanotubes  a  red  shift  of  2  nm  is  observed, for (10, 0) nanotube a blue shift of 6nm is observed as shown in     A NANO-BIOSENSOR FOR DNA SEQUENCE DETECTION… 781 Table 4. The observed behavior of peak shifting can be related to the chiral angles of the nanotubes. Ohno et al. [20] have studied the effect of chirality & diameter of the nanotubes on the change in optical band gap E11 and E22 (corresponding to l11 and l22) due to change in dielectric constant of local environment of the SWNTs for type I and type II SWNTs separately. They have found that for family I SWNTs that DE11 increases with increasing chiral angles while for family II SWNTs the trend is opposite i.e. DE11 decreases with increasing chiral angles. It is further shown by these authors that for family II tubes for lower chiral angles (till ~ 15 °) E22 peaks gets blue shifted with decrease in dielectric constant and for higher angles a red shift of E22 peaks is observed. Our results (family II) are in agreement with Ohno et al. [20] results. In our case, for (10, 0) nanotube the chiral angle is 0° and therefore a large shifting of 20nm is observed in E11 peak while for other two tubes the estimated chiral angles are 26° and 28° that’s  why  a  lesser peak shift is observed. Further, for E22 peaks, the absorption peak of (10, 0) tube (chiral angle 0°)  gets  blue  shifted  by  6  nm  and  for  other  two  tubes (26° and 28° angle) peaks are red shifted (Table 4).   Table 4 – Shifting of second order absorption peaks of SWNTs due to cDNA hybridization  S.No. Before Hybridization After Hybridization DE22 =  E22 – E'22 (eV) Chirality (n, m) Angle (q°) Diameter (nm)  l22 (nm) E22 (eV) l'22 (nm) E'22 (eV)     1 570 2.1754 572 2.1678 0.0076 (6, 5) 26 0.757 2 540 2.296 534 2.322 -0.026 (10, 0) 0 0.794 3 800 1.55 802 1.546 0.0097 (9, 8) 28 1.17  A possible explanation for these observations was given by J. Jiang et al. [21]. These authors said that dependence of chiral angle on the exciton binding energy in SWNTs comes via an effective mass m* so that binding energy is proportional to (m*)a – 1 where a is an empirical parameter.  4. CONCLUSION  It is concluded that DNA-SWNT hybrid system can be used as an efficient bio-sensing probe to detect a known antigen. The sensitivity of the sensor is strongly dominated by the chirality of SWNTs. While the high chiral angled tubes do not give any significant signal for cDNA hybridization, the low chiral angled SWNTs have proved themselves a promising candidate for DNA sensing.  REFERENCES 1. P.W. Barone, S. Baik, D.A. Heller, M.S. Strano, Nat. Mater. 4, 86 (2005). 2. A. Star, E. Tu, J. Niemann, J.C.P. Gabriel, C.S. Joiner, C. Valcke, PNAS 103(4), 921 (2006).    782 J. BANSAL, I. SINGH, N. MATHUR, ET AL.  3. H. Gao, Y. Kong, Annu. Rev. Mater. Res. 34, 123 (2004). 4. S. Han, D. Ralin, J. Wang, X. Li, F. Zhou, Langmuir 19, 8943 (2003). 5. J.M. Jaklevic, H.R. Garmer, G.A. Miller, Annu. Rev. Biomed. Eng. 01, 649 (1999). 6. A.V. Vasiliskov, E.N. Timofeev, S.A. Surzhikov, A.L. Drobyshev, V.V. Shick, A.D. Mirzabekov, Biotechniques 27, 592 (1999). 7. Hornes et al: Oligonucleotide linked magnetic Particles and uses thereof. US Patent 5, 512, 439, 1996. 8. J. Li, H.T. Ng, A. Cassell, W. Fan, H. Chen, Q. Ye, J. Koehne, J. Han, M. Meyyappan, Nano Lett. 3(5), 597 (2003). 9. M. Minunni, S. Tombelli, E. Mariotti, M. Mascini, Fresenius J. Anal. Chem. 369, 589 (2001). 10. N. Mathur, A. Aneja, P.K. Bhatnagar, P.C. Mathur, J. of Sensors 2008, 1 (2008). 11. A. Aneja, N. Mathur, P.K. Bhatnagar, P.C. Mathur, J. Biol. Phys. 34, 487 (2008). 12. H. Cai, X. Cao, Y. Jiang, P. He, Y. Fang, Anal. Bioanal. Chem. 375, 287 (2003). 13. H.J. Dai, J.H. Hafner, A.G. Rinzler, D.T. Colbert, R.E. Smalley, Nature 384, 147 (1996). 14. X. Zhao, K. Johnson (http://puccini.che.pitt.edu/~karlj/Papers/DNA-SWNT.pdf). 15. M. Zheng, A. Jagota, M.S. Strano, A.P. Santos, P. Barone, G. Chou, B.A. Diner, M.S. Dresselhaus, R.S. Mclean, G.B. Onoa, G.G. Samsonidze, E.D. Semke, M. Usrey, D.J. Walls, Science 302, 1545 (2003). 16. M. Zheng, A. Jagota, E.D. Semke, B.A. Diner, R.S. Mclean, S.R. Lusting, R.E. Richardson, N.G. Tassi, Nat. Mater. 2, 338 (2003). 17. E.S. Jeng, A.E. Moll, A.C. Roy, J.B. Gastala, M.S. Strano, Nano Lett. 6, 371 (2006). 18. Y. Ohno, S. Maruyama (http://www.intechopen.com/articles/show/title/). 19. R.B. Weisman, S.M. Bachilo, Nano Lett. 3, 1235 (2003). 20. Y. Ohno, S. Iwasaki, Y. Murakami, S. Kishimoto, S. Maruyama, T. Mizutani, Phys. Rev. B 73, 235427 (2006). 21. J. Jiang, R. Saito, G.G. Samsonidze, A. Jorio, S.G. Chou, G. Dresselhaus, M.S. Dresselhaus, Phys. Rev. B 75, 035407 (2007). 

https://essuir.sumdu.edu.ua/bitstream/123456789/22121/1/Bansal.pdf

A nano-biosensor for DNA sequence detection using absorption spectra of SWNT-DNA composite

Abstract

Similar works

Full text

Available Versions

SocioEconomic Challenges Journal (Sumy State University)

Electronic Sumy State University Institutional Repository