COPPOLA, MARIANGELA

CORRADO, GIANDOMENICO

DIGILIO, MARIA CRISTINA

RAO, ROSA

Ruocco M.

Archivio della ricerca - Università degli studi di Napoli Federico II

20 MINERVA BIOTECNOLOGICA June 2010In Solanaceae, a family of related peptide hor-mones called systemins are involved in the activa-tion of defense genes in response to wounding and herbivory1. A primary wound signal is an 18-aa oli-gopeptide, systemin (Sys), which is located at the C-terminus of a cytosolic precursor protein of 200-aa, prosystemin (ProSys), and released from its precur-sor following wounding with an unknown mecha-nism. Recent studies indicated that Sys up-regulates locally the biosynthesis of Jasmonic Acid (JA)2, the molecule responsible of the systemic wound sign-aling in tomato. ProSys involvement in tomato re-sponse to chewing insects has long been described, but little is known about its role in modulating defence responses to phloem-feeding insects. The feeding habits of these herbivores is very different from chewing larvae, and cause little mechanical damage to plant tissues. Furthermore, as plant re-sponse to stress is regulated by a number of coordi-nated and interconnected pathways, it is interesting to investigate the role of systemin in the activation of plant response to other biotic stresses such as phy-topathogenic fungi. The involvement of systemin in the systemic activation of coordinated defence re-sponses has been recently proposed showing that ProSys overexpression in tomato upregulates genes involved in the production of volatile compounds that attracts herbivore natural enemies3. Our aim was to investigate if systemin-mediated response in tomato, influences the performance of the phytopathogenic fungus Botrytis cinerea and of the aphid Macrosiphon euphorbiae. We showed that the constitutive overexpression of ProSys and of a mutated precursor protein lacking the Sys cod-ing region, is involved in tomato resistance against fungi and aphids. Materials and methodsTransgenic tomato (Solanum lycopersicum cv. ‘Red Setter’) plants were obtained by Agrobacterium tu-mefaciens mediated transformation using the binary vector pRSYS, carrying the entire ProSys cDNA, or the binary vector pRSYSdel, with a truncated ProSys cDNA that lacks the Sys coding region. The coding sequences of the transgenes are under the control of the 35S RNA CaMV promoter. Transgenic and un-trasformed plants were grown in sterilized soil and maintained in controlled environmental chambers for 3 weeks from sowing at 25°C with a photope-riod of 16:8hr light/dark. Transgene presence was verified by PCR (Table I) targeting ProSys and RbcS terminator sequences. Total RNA was prepared from leaves by a phenol/chloroform extraction and a lithium chloride precip-itation and treated with RNase-free DNaseI (Invitro-gen) to remove residual genomic DNA. First-strand cDNA was synthesized using Revertaid first strand-cDNA synthesis kit (Fermentas) and controlled by  MINERVA BIOTEC 2010;22 Suppl. 1 No. 2:20-2Prosystemin coordinates multiple defense responses in tomatoM. COPPOLA1, M. RUOCCO2, M.C. DIGILIO3, G. CORRADO1, R. RAO11Dipartimento di Scienze del Suolo, della Pianta, dell’Ambiente e delle Produzioni Animali, Portici (NA), Italy2Dipartimento di Arboricoltura, Botanica e Patologia Vegetale, Portici (NA), Italy3Dipartimento di Entomologia e Zoologia Agraria “Filippo Silvestri”, Portici (NA), ItalyVol. 22 - Suppl. 1 No. 2 MINERVA BIOTECNOLOGICA 21amplyfing the cDNA of the Elongation Factor1-α, a constitutivly expressed gene. Primer were designed to be able to detect contaminant genomic DNA as they anneal on adjacent exons (Table I). To quantify prosystemin expression, real time RT-PCR was per-formed using a Rotor Gene 6000 machine (Corbett Research) using primers annealing on exons 10 and 11 for RSYS plants, and primers annealing on exons 9 and 10 for RSYSdel plants (Table I). Transgene expression was quantified with ΔΔCT method us-ing the Sybr Green chemistry. Analysis was carried out on three biological replicates of each selected transgenic genotype in comparison to control un-transformed plants.Conidia from the fungus Botrytis cinerea were produced by growing the fungus at 20°C on Potato Dextrose Agar. Fungal coltures were suspended in water, filtered to remove hyphal fragments and di-luted to a 106 propagules/m1 concentration. Ten µl of this suspension were spotted three times on each tomato leaves and each spot was marked by a black pen; the major and minor axes of necrotic areas were measured using a digital caliber every 3 days on four plants per genotype. The aphid Macrosiphon euphorbiae was continu-ously reared on Solanum lycopersicum cv. ‘San Mar-zano’ in an growth chamber at 20±1°C, 65±5% RH, 18:6hr light/dark. For the bioassay, forty RSYS and ‘Red Setter’ plants were infested with a newly born first instar nymph. The presence of aphid and of exuviae were monitored daily. Table I.—Primer sequences and amplification conditions.Tm=Melting temperature; NR=Number of cycle repetition; PL=Primer lenght; AL=Amplicon lenghtSequence(5’→3’)PL(bp)AL(bp) Gene Accession Number Tm1 Cycle NRPC-BBSBB Fw GGGAGGGTGCACTAGAAATA 20 1102 7173Prosys M84801.1M84800.1(McGurl et al. 1992)60 30 sec a 95ºC30 sec a 51ºC2 min a 72ºC30PC-BBSBB Rv TTGCATTTTGGGAGGATCAC 20 58Pc-LeEf Fw AAGCTGCTGAGATGAACAAG 20 68747675EF1-α X14449.1X53043.1(Shewmaker et al.1990)58 45 sec a 94 ºC45 sec a 53 ºC45 sec a 72 ºC25Pc-LeEf Rw GTCAAACCAGTAGGGCCAAA 20 54MCOP RbcS Rv TTGTCGAAACCGATGATACG 20 10861607RbcS M21375(Hunt et al., 1988)58 BBSBBconditionFigure 2.—Bioassay against Botrytis cinerea. A: necrosis areas cal-culated on RSYSdel plants (lines 22 and 16) in comparison to’ Red Setter’ at 3,5,8,11 and 18 days post-inoculi. B: necrosis areas calculated on RSYS plants (lines 17 and 24) in comparison to ‘Red Setter’’ at 3,4,5,8,11,15,18 days post-inoculi.Figure 1.—Relative quantification of prosystemin expression by Real Time RT-PCR. The graph diplays the prosystemin relative quantity (RQ; RQ=2-ΔΔCt), shown on a linear scale relative to the calibrator genotype (Red Setter) in RSYS and RSYSdel transgenic lines. Three plants were used for each genotype and each PCR reaction was done in duplicate. 22 MINERVA BIOTECNOLOGICA June 2010Results and discussionPlant genetic transformation was carried out with the pRSYS or pRSYSdel plasmids and allowed the regeneration of 65 and 88 putative transformed lines, respectively. PCR analysis identified 17 and 54 trans-genic lines, respectevely. The level of expression of ProSys gene was quantified by real time PCR. RSYS and RSYSdel plant populations show different ex-pression levels, as expected, which ranged from 0,2 to 90. According to ProSys expression level (Figure 1), two RSYS (17, 24) and two RSYSdel (16, 22) trans-genic lines were selected for bioassays to evaluate resistance against the phytopathogenic fungus B. cinerea and the aphid M. euphorbiae Figure 2 shows the results of the bioassay with B. cinerea. Both RSYS and RSYSdel plants showed smaller necrosis than ‘Red Setter’ plants. RSYS17 plants show an intermediate behavior between RSYS24 and control plants.Transgenic plants were also assayed with the aphid M. euphorbiae. The maximum intrinsic rate of population increase (rm) was not calculated be-cause of the inability of the aphid strain to repro-duce on tomato cv. ‘Red Setter’. Aphids on RSYS plants had a significantly reduced longevity in com-parison to that showed on the control plants (Figure 3), suggesting that transgenic lines are more resist-ant to this aphid. In conclusion, our study suggests that Sys is in-volved in the protection of tomato plants against phytopatogenic fungi and floem feeding pests. In addition, we showed that the N-terminal region of the ProSys precursor is involved in the activation of defense against fungi, contrasting previous hy-pothesis about the role of the precursor protein4. It is possible that the activation of JA due to the con-stitutive expression of ProSys in transgenic plants allows plants to be pre-adapted to different type of stresses5. Future transcriptomic work will verify this hypothesis.References 1. Pearce G, Ryan CA. Systemins: A functionally defined family of peptide signals that regulate defensive genes in Solanaceae species. PNAS 2003;100:14577-80.  2. Howe GA. Jasmonates as signals in the wound response. J Plant Growth Regul 2005;23:223-37. 3. Corrado G, Sasso R, Pasquariello M, Iodice L, Carretta A, Cascone P, et al. Systemin Regulates Both Systemic and Vola-tile Signaling in Tomato Plants. Journal of Chemical Ecology 2007;4:669-81 4. Dombrowski JE, Pearce G, Ryan CA. Proteinase inhibitor-in-ducing activity of the prohormone prosystemin resides exclu-sively in the C-terminal systemin domain. Proc Natl Acad Sci USA 1999;96:12947-52. 5. Orsini F, Cascone P, De Pascale S, Barbieri G, Corrado G, Rao R et al. Systemin-dependent salinity tolerance in tomato : evi-dence of specific convergence of abiotic and biotic stress re-sponces. Physiologia Plantarum 2010 ;138:10-21.Figure 3.—Aphid bioassay. Aphid longevity measured on RSYS plants (line 24) in comparison to ‘Red Setter’ plants. *:p<0,05 (t-Student’s test).

Prosystemin coordinates multiple defense responses in tomato

Abstract

Similar works

Full text

Available Versions

Archivio della ricerca - Università degli studi di Napoli Federico II