Lipopolysaccharide-pretreated plasmacytoid dendritic cells ameliorate experimental chronic kidney disease

Plasmacytoid dendritic cells play important roles in inducing immune tolerance, preventing allograft rejection, and regulating immune responses in both autoimmune disease and graft-versus-host disease. In order to evaluate a possible protective effect of plasmacytoid dendritic cells against renal inflammation and injury, we purified these cells from mouse spleens and adoptively transferred lipopolysaccharide (LPS)-treated cells, modified ex vivo, into mice with adriamycin nephropathy. These LPS-treated cells localized to the kidney cortex and the lymph nodes draining the kidney, and protected the kidney from injury during adriamycin nephropathy. Glomerulosclerosis, tubular atrophy, interstitial expansion, proteinuria, and creatinine clearance were significantly reduced in mice with adriamycin nephropathy subsequently treated with LPS-activated plasmacytoid dendritic cells as compared to the kidney injury in mice given naive plasmacytoid dendritic cells. In addition, LPS-pretreated cells, but not naive plasmacytoid dendritic cells, convert CD4+CD25− T cells into Foxp3+ regulatory T cells and suppress the proinflammatory cytokine production of endogenous renal macrophages. This may explain their ability to protect against renal injury in adriamycin nephropathy

Efficient Sensing of Avian Influenza Viruses by Porcine Plasmacytoid Dendritic Cells

H5N1 influenza A virus (IAV) infections in human remain rare events but have been associated with severe disease and a higher mortality rate compared to infections with seasonal strains. An excessive release of pro-inflammatory cytokine together with a greater virus dissemination potential have been proposed to explain the high virulence observed in human and other mammalian and avian species. Among the cells involved in the cytokine storm, plasmacytoid dendritic cells (pDC) could play an important role considering their unique capacity to secrete massive amounts of type I interferon (IFN). Considering the role of IFN as a major component of antiviral responses as well as in priming inflammatory responses, we aimed to characterize the induction of IFN-α release upon infection with IAV originating from various avian and mammalian species in a comparative way. In our porcine pDC model, we showed that the viral components triggering IFN responses related to the ability to hemagglutinate, although virosomes devoid of viral RNA were non-stimulatory. Heat-treatment at 65 °C but not chemical inactivation destroyed the ability of IAV to stimulate pDC. All IAV tested induced IFN-α but at different levels and showed different dose-dependencies. H5 and H7 subtypes, in particular H5N1, stimulated pDC at lower doses when compared to mammalian IAV. At high viral doses, IFN-α levels reached by some mammalian IAV surpassed those induced by avian isolates. Although sialic acid-dependent entry was demonstrated, the α-2,3 or α-2,6 binding specificity alone did not explain the differences observed. Furthermore, we were unable to identify a clear role of the hemagglutinin, as the IFN-α doses-response profiles did not clearly differ when viruses with all genes of identical avian origin but different HA were compared. This was found with IAV bearing an HA derived from either a low, a high pathogenic H5N1, or a human H3. Stimulation of pDC was associated with pDC depletion within the cultures. Taken together and considering the efficient sensing of H5N1 at low dose, pDC on one side may play a role in the cytokine storm observed during severe disease, on the other hand could participate in early antiviral responses limiting virus replication

Human plasmacytoid dendritic cells and cutaneous melanoma

The prognosis of metastatic melanoma (MM) patients has remained poor for a long time. However, the recent introduction of effective target therapies (BRAF and MEK inhibitors for BRAFV600-mutated MM) and immunotherapies (anti-CTLA-4 and anti-PD-1) has significantly improved the survival of MM patients. Notably, all these responses are highly dependent on the fitness of the host immune system, including the innate compartment. Among immune cells involved in cancer immunity, properly activated plasmacytoid dendritic cells (pDCs) exert an important role, bridging the innate and adaptive immune responses and directly eliminating cancer cells. A distinctive feature of pDCs is the production of high amount of type I Interferon (I-IFN), through the Toll-like receptor (TLR) 7 and 9 signaling pathway activation. However, published data indicate that melanoma-associated escape mechanisms are in place to hijack pDC functions. We have recently reported that pDC recruitment is recurrent in the early phases of melanoma, but the entire pDC compartment collapses over melanoma progression. Here, we summarize recent advances on pDC biology and function within the context of melanoma immunity

MHC class II-restricted antigen presentation by plasmacytoid dendritic cells drives proatherogenic T cell immunity

Background—Plasmacytoid dendritic cells (pDCs) bridge innate and adaptive immune responses and are important regulators of immuno-inflammatory diseases. However, their role in atherosclerosis remains elusive. Methods and Results—Here, we used genetic approaches to investigate the role of pDCs in atherosclerosis. Selective pDC deficiency in vivo was achieved using CD11c-Cre × Tcf4–/flox bone marrow transplanted into Ldlr–/– mice. Compared with control Ldlr–/– chimeric mice, CD11c-Cre × Tcf4–/flox mice had reduced atherosclerosis levels. To begin to understand the mechanisms by which pDCs regulate atherosclerosis, we studied chimeric Ldlr–/– mice with selective MHCII deficiency on pDCs. Significantly, these mice also developed reduced atherosclerosis compared with controls without reductions in pDC numbers or changes in conventional DCs. MHCII-deficient pDCs showed defective stimulation of apolipoprotein B100–specific CD4+ T cells in response to native low-density lipoprotein, whereas production of interferon-α was not affected. Finally, the atheroprotective effect of selective MHCII deficiency in pDCs was associated with significant reductions of proatherogenic T cell–derived interferon-γ and lesional T cell infiltration, and was abrogated in CD4+ T cell–depleted animals. Conclusions—This study supports a proatherogenic role for pDCs in murine atherosclerosis and identifies a critical role for MHCII-restricted antigen presentation by pDCs in driving proatherogenic T cell immunity

Blocking TLR7- and TLR9-mediated IFN-α Production by Plasmacytoid Dendritic Cells Does Not Diminish Immune Activation in Early SIV Infection

Persistent production of type I interferon (IFN) by activated plasmacytoid dendritic cells (pDC) is a leading model to explain chronic immune activation in human immunodeficiency virus (HIV) infection but direct evidence for this is lacking. We used a dual antagonist of Toll-like receptor (TLR) 7 and TLR9 to selectively inhibit responses of pDC but not other mononuclear phagocytes to viral RNA prior to and for 8 weeks following pathogenic simian immunodeficiency virus (SIV) infection of rhesus macaques. We show that pDC are major but not exclusive producers of IFN-α that rapidly become unresponsive to virus stimulation following SIV infection, whereas myeloid DC gain the capacity to produce IFN-α, albeit at low levels. pDC mediate a marked but transient IFN-α response in lymph nodes during the acute phase that is blocked by administration of TLR7 and TLR9 antagonist without impacting pDC recruitment. TLR7 and TLR9 blockade did not impact virus load or the acute IFN-α response in plasma and had minimal effect on expression of IFN-stimulated genes in both blood and lymph node. TLR7 and TLR9 blockade did not prevent activation of memory CD4+ and CD8+ T cells in blood or lymph node but led to significant increases in proliferation of both subsets in blood following SIV infection. Our findings reveal that virus-mediated activation of pDC through TLR7 and TLR9 contributes to substantial but transient IFN-α production following pathogenic SIV infection. However, the data indicate that pDC activation and IFN-α production are unlikely to be major factors in driving immune activation in early infection. Based on these findings therapeutic strategies aimed at blocking pDC function and IFN-α production may not reduce HIV-associated immunopathology. © 2013 Kader et al

ChemR23 Dampens Lung Inflammation and Enhances Anti-viral Immunity in a Mouse Model of Acute Viral Pneumonia

Viral diseases of the respiratory tract, which include influenza pandemic, children acute bronchiolitis, and viral pneumonia of the elderly, represent major health problems. Plasmacytoid dendritic cells play an important role in anti-viral immunity, and these cells were recently shown to express ChemR23, the receptor for the chemoattractant protein chemerin, which is expressed by epithelial cells in the lung. Our aim was to determine the role played by the chemerin/ChemR23 system in the physiopathology of viral pneumonia, using the pneumonia virus of mice (PVM) as a model. Wild-type and ChemR23 knock-out mice were infected by PVM and followed for functional and inflammatory parameters. ChemR23−/− mice displayed higher mortality/morbidity, alteration of lung function, delayed viral clearance and increased neutrophilic infiltration. We demonstrated in these mice a lower recruitment of plasmacytoid dendritic cells and a reduction in type I interferon production. The role of plasmacytoid dendritic cells was further addressed by performing depletion and adoptive transfer experiments as well as by the generation of chimeric mice, demonstrating two opposite effects of the chemerin/ChemR23 system. First, the ChemR23-dependent recruitment of plasmacytoid dendritic cells contributes to adaptive immune responses and viral clearance, but also enhances the inflammatory response. Second, increased morbidity/mortality in ChemR23−/− mice is not due to defective plasmacytoid dendritic cells recruitment, but rather to the loss of an anti-inflammatory pathway involving ChemR23 expressed by non-leukocytic cells. The chemerin/ChemR23 system plays important roles in the physiopathology of viral pneumonia, and might therefore be considered as a therapeutic target for anti-viral and anti-inflammatory therapies

Molecular mechanisms of autoimmunity triggered by microbial infection

Autoimmunity can be triggered by microbial infection. In this context, the discovery of Toll-like receptors (TLRs) provides new insights and research perspectives. TLRs induce innate and adaptive antimicrobial immune responses upon exposure to common pathogen-associated molecules, including lipopeptides, lipopolysaccharides, and nucleic acids. They also have the potential, however, to trigger autoimmune disease, as has been revealed by an increasing number of experimental reports. This review summarizes important facts about TLR biology, available data on their role in autoimmunity, and potential consequences for the management of patients with autoimmune disease

Clinical significance of plasmacytoid dendritic cells and myeloid-derived suppressor cells in melanoma

Background: Immune markers in the peripheral blood of melanoma patients could provide prognostic information. However, there is currently no consensus on which circulating cell types have more clinical impact. We therefore evaluated myeloid-derived suppressor cells (MDSC), dendritic cells (DC), cytotoxic T-cells and regulatory T-cells (Treg) in a series of blood samples of melanoma patients in different stages of disease. Methods: Flow cytometry was performed on peripheral blood mononuclear cells of 69 stage I to IV melanoma patients with a median follow-up of 39 months after diagnosis to measure the percentage of monocytic MDSCs (mMDSCs), polymorphonuclear MDSCs (pmnMDSCs), myeloid DCs (mDCs), plasmacytoid DCs (pDCs), cytotoxic T-cells and Tregs. We also assessed the expression of PD-L1 and CTLA-4 in cytotoxic T-cells and Tregs respectively. The impact of cell frequencies on prognosis was tested with multivariate Cox regression modelling. Results: Circulating pDC levels were decreased in patients with advanced (P = 0.001) or active (P = 0.002) disease. Low pDC levels conferred an independent negative impact on overall (P = 0.025) and progression-free survival (P = 0.036). Even before relapse, a decrease in pDC levels was observed (P = 0.002, correlation coefficient 0.898). High levels of circulating MDSCs (>4.13%) have an independent negative prognostic impact on OS (P = 0.012). MDSC levels were associated with decreased CD3+ (P < 0.001) and CD3 + CD8+ (P = 0.017) T-cell levels. Conversely, patients with high MDSC levels had more PD-L1+ T-cells (P = 0.033) and more CTLA-4 expression by Tregs (P = 0.003). pDCs and MDSCs were inversely correlated (P = 0.004). The impact of pDC levels on prognosis and prediction of the presence of systemic disease was stronger than that of MDSC levels. Conclusion: We demonstrated that circulating pDC and MDSC levels are inversely correlated but have an independent prognostic value in melanoma patients. These cell types represent a single immunologic system and should be evaluated together. Both are key players in the immunological climate in melanoma patients, as they are correlated with circulating cytotoxic and regulatory T-cells. Circulating pDC and MDSC levels should be considered in future immunoprofiling efforts as they could impact disease management

Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases