A novel mechanism for binding of galactose-terminated glycans by the C-type carbohydrate recognition domain in blood dendritic cell antigen 2

Blood dendritic cell antigen 2 (BDCA-2; also designated CLEC4C or CD303) is uniquely expressed on plasmacytoid dendritic cells. Stimulation of BDCA-2 with antibodies leads to an anti-inflammatory response in these cells, but the natural ligands for the receptor are not known. The C-type carbohydrate recognition domain in the extracellular portion of BDCA-2 contains a signature motif typical of C-type animal lectins that bind mannose, glucose, or GlcNAc, yet it has been reported that BDCA-2 binds selectively to galactose-terminated, biantennary N-linked glycans. A combination of glycan array analysis and binding competition studies with monosaccharides and natural and synthetic oligosaccharides have been used to define the binding epitope for BDCA-2 as the trisaccharide Galβ1–3/4GlcNAcβ1–2Man. X-ray crystallography and mutagenesis studies show that mannose is ligated to the conserved Ca2+ in the primary binding site that is characteristic of C-type carbohydrate recognition domains, and the GlcNAc and galactose residues make additional interactions in a wide, shallow groove adjacent to the primary binding site. As predicted from these studies, BDCA-2 binds to IgG, which bears galactose-terminated glycans that are not commonly found attached to other serum glycoproteins. Thus, BDCA-2 has the potential to serve as a previously unrecognized immunoglobulin Fc receptor

Quantum-Dot Cellular Automata using Buried Dopants

The use of buried dopants to construct quantum-dot cellular automata is investigated as an alternative to conventional electronic devices for information transport and elementary computation. This provides a limit in terms of miniaturisation for this type of system as each potential well is formed by a single dopant atom. As an example, phosphorous donors in silicon are found to have good energy level separation with incoherent switching times of the order of microseconds. However, we also illustrate the possibility of ultra-fast quantum coherent switching via adiabatic evolution. The switching speeds are numerically calculated and found to be 10's of picoseconds or less for a single cell. The effect of decoherence is also simulated in the form of a dephasing process and limits are estimated for operation with finite dephasing. The advantages and limitations of this scheme over the more conventional quantum-dot based scheme are discussed. The use of a buried donor cellular automata system is also discussed as an architecture for testing several aspects of buried donor based quantum computing schemes.Comment: Minor changes in response to referees comments. Improved section on scaling and added plot of incoherent switching time

The Boosted DC Algorithm for Clustering with Constraints

This paper aims to investigate the effectiveness of the recently proposed Boosted Difference of Convex functions Algorithm (BDCA) when applied to clustering with constraints and set clustering with constraints problems. This is the first paper to apply BDCA to a problem with nonlinear constraints. We present the mathematical basis for the BDCA and Difference of Convex functions Algorithm (DCA), along with a penalty method based on distance functions. We then develop algorithms for solving these problems and computationally implement them, with publicly available implementations. We compare old examples and provide new experiments to test the algorithms. We find that the BDCA method converges in fewer iterations than the corresponding DCA-based method. In addition, BDCA yields faster CPU running-times in all tested problems

Functional Integral Approach in the Theory of Color Superconductivity

In this series of lectures we present the functional integral method for studying the superconducting pairing of quarks with the formation of the diquarks as well as the quark-antiquark pairing in dense QCD. The dynamical equations for the superconducting order parameters are the nonlinear integral equations for the composite quantum fields describing the quark-quark or quark-antiquark systems. These composite fields are the bi-local fields if the pairing is generated by the gluon exchange while for the instanton induced pairing interactions they are the local ones. The expressions of the free energy densities are derived. The binding of three quarks is also discussed.Comment: 21 pages, 2 figures, Lectures at the VIth Vietnam International School in Theoretical Physics, Vung Tau, 27 December 1999 -- 08 January 200

Recent insights into structures and functions of C-type lectins in the immune system

The majority of the C-type lectin-like domains in the human genome likely to bind sugars have been investigated structurally, although novel mechanisms of sugar binding are still being discovered. In the immune system, adhesion and endocytic receptors that bind endogenous mammalian glycans are often conserved, while pathogen-binding C-type lectins on cells of the innate immune system are more divergent. Lack of orthology between some human and mouse receptors, as well as overlapping specificities of many receptors and formation of receptor hetero-oligomers, can make it difficult to define the roles of individual receptors. There is good evidence that C-type lectins initiate signalling pathways in several different ways, but this function remains the least well understood from a mechanistic perspective

Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases