SameSameButDifferent v.02 – Iceland

The history of computer music is to a great extent the history of algorithmic composition. Here generative approaches are seen as an artistic technique. However, the generation of algorithmic music is normally done in the studio, where the music is aesthetically valued by the composer. The public only gets to know one, or perhaps few, variations of the expressive scope of the algorithmic system itself. In this paper, we describe a generative music system of infinite compositions, where the system itself is aimed for distribution and to be used on personal computers. This system has a dual structure of a compositional score and a performer that performs the score in real-time every time a piece is played. We trace the contextual background of such systems and potential future applications

Algorithms as scores: coding live music

The author discusses live coding as a new path in the evolution of the musical score. Live-coding practice accentu- ates the score, and whilst it is the perfect vehicle for the performance of algorithmic music it also transforms the compositional process itself into a live event. As a continuation of 20th-century artistic developments of the musical score, live-coding systems often embrace graphical elements and language syntaxes foreign to standard programming languages. The author presents live coding as a highly technologized artistic practice, shedding light on how non-linearity, play and generativity will become prominent in future creative media productions

Antifungal activity of lactic acid bacteria

Enrichment culture techniques produced more than 1200 isolates of lactic acid bacteria (LAB) that were screened for antifungal activity against the indicator mould Aspergillus fumigatus. Approximately 10% of the LAB were active, but only 4% had medium or strong activity in an agar plate assay. The majority of isolates with strong antifungal activity were Lactobacillus coryniformis strains, but Lactobacillus plantarum and Pediococcus pentosaceus were also frequently identified. Some of the isolates lost activity during storage but most maintained their fungal inhibitory effect. Large variations in sensitivity were observed between different moulds and yeasts. Antifungal cyclic dipeptides and phenyllactic acid were detected in culture filtrates from several of the LAB isolates. Lactobacillus coryniformis subsp. coryniformis strain Si3 produced an antifungal compound that lost activity when treated with proteinases. The antifungal peptide(s) was heat stable, with a size of approx. 3kDa and had maximum activity at pH 3.0 to 4.5. Addition of ethanol to the growth medium of strain Si3 prevented a decline in observed antifungal activity during the stationary phase. Glycerol addition to agar plates with L. coryniformis strains, overlaid with soft agar suspensions of yeast cells or fungal spores, strongly enhanced the antifungal effect. This was particularly true with spoilage moulds and yeasts, e.g. Penicillium roqueforti and Pichia anomala, not normally affected by the antifungal metabolites of L. coryniformis. Chemical and genetic data suggested that reuterin (3-hydroxypropionaldehyde) was the cause of this effect. The glycerol/diol dehydratase operon of L. coryniformis was partially elucidated and found to be similar to that Lactobacillus collinoides. Bioassay-guided isolation of new metabolites from LAB revealed that Lactobacillus plantarum MiLAB 14 produces hydroxylated fatty acids with strong antifungal effects. 3-Hydroxydecanoic acid, 3-hydroxydodecanoic acid, 3-hydroxytetradecanoic acid and 3-hydroxy-5-cis-dodecenoic acid were characterized from the supernatant of MiLAB 14. The hydroxy fatty acids had total inhibitory effects in the range 10 to >100 µg ml-1 against several moulds and yeasts

Of epistemic tools: musical instruments as cognitive extensions

This paper explores the differences in the design and performance of acoustic and new digital musical instruments, arguing that with the latter there is an increased encapsulation of musical theory. The point of departure is the phenomenology of musical instruments, which leads to the exploration of designed artefacts as extensions of human cognition – as scaffolding onto which we delegate parts of our cognitive processes. The paper succinctly emphasises the pronounced epistemic dimension of digital instruments when compared to acoustic instruments. Through the analysis of material epistemologies it is possible to describe the digital instrument as an epistemic tool: a designed tool with such a high degree of symbolic pertinence that it becomes a system of knowledge and thinking in its own terms. In conclusion, the paper rounds up the phenomenological and epistemological arguments, and points at issues in the design of digital musical instruments that are germane due to their strong aesthetic implications for musical culture

Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases

Confessions of a live coder

This paper describes the process involved when a live coder decides to learn a new musical programming language of another paradigm. The paper introduces the problems of running comparative experiments, or user studies, within the field of live coding. It suggests that an autoethnographic account of the process can be helpful for understanding the technological conditioning of contemporary musical tools. The author is conducting a larger research project on this theme: the part presented in this paper describes the adoption of a new musical programming environment, Impromptu, and how this affects the author’s musical practice

The ixiQuarks: merging code and GUI in one creative space

This paper reports on ixiQuarks; an environment of instruments and effects that is built on top of the audio programming language SuperCollider. The rationale of these instruments is to explore alternative ways of designing musical interaction in screen-based software, and investigate how semiotics in interface design affects the musical output. The ixiQuarks are part of external libraries available to SuperCollider through the Quarks system. They are software instruments based on a non- realist design ideology that rejects the simulation of acoustic instruments or music hardware and focuses on experimentation at the level of musical interaction. In this environment we try to merge the graphical with the textual in the same instruments, allowing the user to reprogram and change parts of them in runtime. After a short introduction to SuperCollider and the Quark system, we will describe the ixiQuarks and the philosophical basis of their design. We conclude by looking at how they can be seen as epistemic tools that influence the musician in a complex hermeneutic circle of interpretation and signification

The threnoscope: a musical work for live coding performance

This paper introduces a new direction in the field of artistic live coding where musical works are presented as pieces in the form of a live coding system. The system itself and the code affordances become equivalent to score system in an open musical work for strong improvisation

When instruments become architecture: on liquefying frozen music

No description supplie

Improvising with the threnoscope: integrating code, hardware, GUI, network, and graphic scores

Live coding emphasises improvisation. It is an art practice that merges the act of musical composition and performance into a public act of projected writing. This paper introduces the Threnoscope system, which includes a live coding micro-language for drone-based microtonal composition. The paper discusses the aims and objectives of the system, elucidates the design decisions, and introduces in particular the code score feature present in the Threnoscope. The code score is a novel element in the design of live coding systems allowing for improvisation through a graphic score, rendering a visual representation of past and future events in a real-time performance. The paper demonstrates how the system’s methods can be mapped ad hoc to GUI- or hardware-based control