PENGARUH KUALITAS PELAYANAN DAN PERSEPSI MANFAAT KOPERASI TERHADAP PARTISIPASI ANGGOTA KOPERASI PEDAGANG PASAR (KOPPAS) KECAMATAN PASAR MINGGU, JAKARTA SELATAN

ABSTRACT HERMANSYAH. The Iinfluence of Service Quality and The Perception of Cooperative`s Benefit To The Participation Of Member of Koperasi Pedagang Pasar (KOPPAS) in Distric of Pasar Minggu, South of Jakarta. Faculty of Economics, State University of Jakarta, 2014. . This study aims to determine how much the influence of service quality and perception of cooperative`s benefit to the participation of member of Koperasi Pedagang Pasar (KOPPAS) in Distric of Pasar Minggu, South of Jakarta. The method of study used survei method with correlation approach. Study population are members of cooperative as many as 278 people. Then taken 69 members as sample. All of variables of this study are revealed have normal distribution and assumes linierity. Multiple linierity regression equation obtained . Simultaneous regression coefficient test (test F) showed that there is influence simultaneously between variable of service quality (X1) and perception of benefit (X2) of cooperative to the participation of cooperative members (Y) by seeing the decision criteria F count 18,540 > F table 3,316. while the partial regression coefficient test (t Test) showed that each of independent variables has the influence to the dependent variables. That can be seen in the decision criteria each variable where t count service quality variabel (X1) amounts 2,212 and the cooperative is benefit perception amounts 3,761 > t table which amount to 1,997. Determination coefficient test showed that the participation of member Koperasi Pedagang Pasar (KOPPAS) simultaneously influence by quality service variable and the perception of cooperative is benefit that can be seen in the value of determination that amounts to 0,360 or 36% the percentage of influences of both independent variables, while the remaining percentage is influenced by other factors. From the above study, it can give the result that there are the influence of service quality and the perception of cooperative is benefit to the participation of members of Koperasi Pedagang Pasar (KOPPAS) in District of Pasar Minggu, South of Jakarta

Religious Practices and Local Magic of Inland Malay Society in West Kalimantan

Belief and practice as part of culture which exists in society is the result of a dynamic process that is growing and developing, and affected by both internal and external aspects of the society. All of this is a manifestation of a continuity of the treasures of humanity. Derivation and transfer of a culture toward forming a new more complex culture is natural and inevitable. There is no culture and civilization in the world built without relationship and interchange with other cultures and civilizations. It is also the case with the religious life of the rural community in West Kalimantan which is the subject of the study in this article. This continuity shows that local communities have a vibrant culture passed down from one generation to the next. The existence of tradition heritage recorded in magic called ilmu in inland Islamic societies of West Kalimantan shows that their peaceful process of accepting Islam since its spread, to a certain extent, accommodates local culture. The dialectic process of Islam and local culture serves as an example of religious acceptance in a massive fashion in a region far away from the coastal area

Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases.  The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role.  In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101).  A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly. 

PENYELESAIAN KONFLIK ETNIS DAN INSTITUSIONALISASI PENGADILAN LOKAL YANG BERBASIS BUDAYA

 Conflict, ethnicity and multicultural matters are natural law, and the conflicts frequently happen are caused by the misunderstanding of the different life objectives, tribe diversity and cultural plurality. In reality, the conflict settlements are often solved through criminal justice system. However, the settlement through the state criminal justice system results in dissatisfaction as it emphasizes more on the procedural justice. People use violence as an expression of their dissatisfaction with the state justice system. In fact there is an institutionalized local justice (customary justice) which can be used to settle conflicts considering that local justice characteristics emphasize more on substantive justice aspects in settling the conflicts and have social basis and base itself on clear cultural based community

MANUSKRIP ACEH: REVITALISASI KEARIFAN MASYARAKAT ACEH DI ERA GLOBAL

Tahun 2004 menjadi titik balik Aceh berbenah dan bangkit dari keterpurukan.Pasca bencana alam (gempa-tsunami) dan bencana kemanusiaan (kon ik)menuntun adanya proses rehabilitasi dan rekonstruksi yang dilakukan olehPemerintah Daerah, Indonesia dan pihak asing (luar negeri) dalam berbagai bidangturut menumbuhkan perekonomian dan sosial masyarakat Aceh dengan pesat.Proses itu tidak hanya fokus di infrastruktur, akan tetapi juga di bidang sosialkeagamaan dan cagar budaya, serta mempengaruhi pola pikir dan cara pandanggenerasi sekarang.Sebagai daerah kaya potensi alam dan mewariskan nilai sejarah dan budayamasa lampau, Aceh bergulir dalam beragam cuaca politik dan kebijakan, mulaidari periode kesultanan, kolonial, hingga kemerdekaan Indonesia. Pergolakan danpeperangan panjang juga menghiasi tiga periode tersebut di Aceh, baik pertikaianinternal, perang saudara, maupun kon ik vertikal dan horizontal. Akibatnya,cagar budaya dan kearifan masyarakat terkubur oleh bencana kemanusia tersebut,terlebih “kekayaan alam dan kearifan” musnah saat bencana alam terbesar terjadidi abad ke-21

ISLAM AND LOCAL CULTURE IN INDONESIA

Muslims believe that their religion is universal, suitable to all places and time. Consequently, in practice, Islam can be adapted to various situations and conditions. Therefore, the diversity in Islam is inevitable. Diversity is especially related to aspects of interpretation and religious branches, not things that are principle. This article is about the relationship between Islam and local culture. As recognized by many experts, Islam in Indonesia was spread by peaceful means. Local elements were used in the process of Islamization. As a result, Islam could be accepted by most of society of Indonesia. Islam expressed here shows a distinctive face. Islam can live hand in hand with local culture, especially the culture that is not incompatible with Islam. Keywords: Islam, Islamization, local culture, diversity

Penentuan Tipe Mating Ragi Saccharomyces Cerevisiae

Dalam penelitian genom ragi S. cerevisiae, penentuan tipe mating berguna terutama dalam konstruksi mutan-mutan melalui metode persilangan. Kami menentukan tipe mating sel-sel strain hasil persilangan strain A dan strain B menggunakan strain tester SH682 yang memiliki tipe mating MATa dan strain tester SH683 yang memiliki tipe mating MATα. Hasil menunjukan dari 11 aski dengan 4 spora menghasilkan 2 spora MATα dan 2 spora MATα untuk setiap aski nya. Hal ini mengindikasikan bahwa penentuan tipe mating merupakan salah satu fenotip yang penting dalam teknik tetrad analisis sebagai metode konvensional dalam penelitian molekular rag