Distribution of Onryza maga (Leech, 1890) (Lepidoptera: Hesperiidae) with description of female genitalia and taxonomic notes

For more than twenty years, Hainan, Vietnam, Myanmar, Thailand, Malaysia, Singapore and Indonesia have been erroneously reported in Chinese literature as belonging to the distribution range of Onryza maga (Leech 1890). Based upon a careful survey of specimens and relevant literature, these regions are omitted from the known range of this species. Onryza maga maga is found from northeast Guizhou, south Henan and Qinling-Daba Mountains in Shaanxi of China, its occurrence in Hunan is confirmed. The adults are redescribed and the variability of wing patterns is discussed. Female genitalia are illustrated and described for the first time. Some biological information and an updated distribution map of the species are provided

New species of subgenus Tipula (Sivatipula) from China, with redescription of T. (S.) parvauricula and a key to all known species of the Oriental Region (Diptera, Tipulidae, Tipula)

Species of Tipula (Sivatipula) biprocessasp. n. from Guangxi, China is described and illustrated as new in the subgenus Tipula (Sivatipula) Alexander, 1964. T. (S.) parvauricula Alexander, 1941 is redescribed and illustrated based on additional morphological characters. Semen pump of this subgenus is discussed. A key to all described species in this group is compiled

Two new species of the genus Nephrotoma (Diptera, Tipuloidea, Tipulidae) from China with a key to species from Mainland China

Nephrotoma liankangensis sp. n. and N. pseudoliankangensis sp. n. are described from males and females collected from Henan and Yunnan provinces, China. Morphological descriptions and illustrations for the new species are provided. A key to known species from mainland China is provided. Some internal reproductive structures, including male semen pump, female vaginal apodeme and spermatheca, are described and compared. The possible usefulness of these internal reproductive structures for separating related species is analyzed. The type specimens are deposited in the animal specimen room, School of Life Sciences, Anqing Normal University, Anhui Province, China

Power flow analysis based dynamic topology optimization of vibrational structures

This paper presents a power plow analysis based dynamic topology optimization of vibrational structures. Up to now, work on topology dynamic optimization of engineering structures for vibration suppression has mainly addressed the maximization of eigenfrequencies and gaps between consecutive eigenfrequencies of free vibration, and minimization of the dynamic compliance subject to harmonic loading on the structure. In this paper, we deal with topology optimization problems formulated directly with the design objective of minimizing the “Energy compliance”, derived from the energy flow equilibrium equation in steady state. The structural vibrations are excited by time-harmonic external mechanical loading with prescribed frequency and amplitude. A density based topology optimization method is developed for power flow problems in steady state using an adjoint design sensitivity analysis (DSA) method. Design variables are parameterized using Bi-material Solid Isotropic Material with Penalization (SIMP) models. The structural damping is considered as Rayleigh damping. The method of Moving Asymptotes (MMA) is applied for design updating. Several numerical examples are demonstrated for different loading frequencies

Hasora mavis Evans, 1934 syn. n. is confirmed to be the female of H. leucospila leucospila (Mabille, 1891) (Hesperiidae, Coeliadinae) by DNA barcoding

Xue, Guoxi, Ikari, Etsuo, Inayoshi, Yutaka, Li, Meng (2019): Hasora mavis Evans, 1934 syn. n. is confirmed to be the female of H. leucospila leucospila (Mabille, 1891) (Hesperiidae, Coeliadinae) by DNA barcoding. Zootaxa 4695 (4): 391-393, DOI: https://doi.org/10.11646/zootaxa.4695.4.

New information on the skipper fauna of Guangxi, China (Lepidoptera, Hesperiidae)

Xue, Guoxi, Niu, Jinqiao, Long, Jifeng, Zeng, Weibo (2018): New information on the skipper fauna of Guangxi, China (Lepidoptera, Hesperiidae). Zootaxa 4497 (2): 258-270, DOI: https://doi.org/10.11646/zootaxa.4497.2.

Fast Detection of the Single Point Leakage in Branched Shale Gas Gathering and Transportation Pipeline Network with Condensate Water

The node pressure and flow rate along the shale gas flow process are analyzed according to the characteristics of the shale gas flow pipe network, and the non-leaking and leaking processes of the shale gas flow pipe network are modeled separately. The changes in pressure over time along each pipe segment in the network provide new ideas for identifying leaking pipe sections. This paper uses the logarithmic value of pressure as the basis for judging whether the flow pipe network is leaking or not, according to the process of varying flow parameters resulting in the regularity of leakage. A graph of the change in pressure of the pipe section after the leak compared to the pressure of the non-leaking section of pipe over time can be plotted, accurately identifying the specific section of pipe with the leak. The accuracy of this novel method is verified by the leakage section and statistical data of the shale gas pipeline network in situ used in this paper

Halpe sikkima Moore 1882

<i>Halpe sikkima</i> Moore, 1882 (Fig. 1) <p> <i>Halpe sikkima</i> Moore, 1882: 407, TL: Sikkim; Elwes & Möller, 1888: 453; Evans, 1949: 260; Eliot, 1992: 350; Osada et al., 1999: 192; Yuan et al., 2007: 310; Ek-Amnuay, 2012: 828; Yuan et al., 2015: 397; Monastyrskii & Devyatkin, 2016: 77.</p> <p> <i>Halpe selangora</i> Swinhoe, 1913: 283, TL: Selangor, Malaya. Synonymised by Evans, 1949.</p> <p> <b>Distribution.</b> Sikkim to Indochina, Hainan, Malay Peninsula, Borneo, Sumatra, Java.</p> <p> <b>Material examined.</b> 1 <i>3</i>, Wuzhishan, Hainan, China, 15.IV.2015, G.X. Xue leg.</p> <p> <b>Male genitalia</b> (Fig. 2). In dorsal view, tegumen slightly tapered; uncus basally constricted and distally expanded, its end deeply bifid into a pair of inwardly curved blunt-pointed horns. Lateral processes reach to half of the horns of uncus, ventral side with a small hook in the middle, distal half thinner and tapered. Gnathos distally tapered and left and right parts separated from each other. Saccus short. Dorsal margin of valva slightly bifid in the middle, basal half flat, without footstalk; distal half densely furnished with strong sawteeth, dorsal margin widely U-shaped, forming a triangular basal branch and a narrower elongated distal branch, of which the distal margin is shallowly indented to form a strong upper branch and a small lower branch. Aedeagus shorter than ventral margin of valva, suprazonal sheath tapered toward fore-end, dorsal margin of subzonal sheath deeply concave. Juxta quadrangular.</p> <p> <b>COI sequence.</b> Genbank Accession MH444659, voucher HaiN-A32, 661 base pairs: ATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCT CTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTAT TGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACT AGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATGTTACCCC CTTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACCGGATGAACAGTTTACCCCC CTCTTTCTTCTAATATTGCTCATCAAGGTTCATCCGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGTATTT CCTCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAA TACCTTTATTCGTTTGAGCTGTAGGAATTACTGCTTTACTTTTATTACTTTCATTACCAGTTTTAGCTGGAGCT ATTACAATATTATTAACTGATCGAAATTTAAATACtTCTTTTTTTGATCCTGCAGGAGGAGGAGATCC</p> <p> <b>Remarks.</b> Evans (1949) recorded one male <i>Halpe sikkima</i> from Hainan. Since then, no more material of this species has been collected from this place again, although field surveys have been carried out on the island repeatedly, and a number of hesperiid species have been published as new to science (Chou 1994; Fan <i>et al</i>. 2007a; Fan <i>et al</i>. 2007b; Fan & Chiba 2008) or discovered as new records to the skipper fauna of China (Fan <i>et al</i>. 2003; Fei <i>et al</i>. 2015). In recent literature specializing in the fauna of Hainan skippers (e.g. Gu & Chen 1997; Gu 2002; Chiba 2008), this species was not included. Thus, <i>H. sikkima</i> remained a mysterious species in Hainan, and its occurrence on the island needed reconfirmation. During a collecting trip at Wuzhishan (Fig. 3) in 2015, a male <i>H. sikkima</i> was captured by the first author of the present paper, representing the second specimen of this species from the island. Considering the figures and descriptions of the male genitalia in literature which are not complete and precise enough (Evans 1949; Maruyama 1991), illustrations and a re-description are provided in this paper. DNA was extracted from one leg of the dried specimen using DNeasy <i>®</i> Blood and Tissue Kit (Qiagen, Germany). The COI gene was amplified by PCR as described by Hajibabaei <i>et al.</i> (2006) and then sequenced by Sangon biotech, Shanghai, China. The COI sequence is published herein for the potential use in DNA barcoding and a molecular phylogeny study in the future.</p>Published as part of <i>Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi & Li, Meng, 2018, Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China, pp. 85-88 in Zootaxa 4486 (1)</i> on pages 85-86, DOI: 10.11646/zootaxa.4486.1.7, <a href="http://zenodo.org/record/1438057">http://zenodo.org/record/1438057</a&gt

A new subspecies and a new synonym of the genus Coladenia (Hesperiidae, Pyrginae) from China

The second subspecies of Coladenia buchananii (de Nicéville, 1889), viz. Coladenia buchananii separafasciata Xue, Inayoshi & Hu, ssp. n., is discovered from south Jiangxi Province and west Fujian Province, southeast China. External and genital characters of both male and female of this new subspecies are illustrated and described. Coladenia neomaeniata Fan & Wang, 2006, syn. n. is proposed to be a junior synonym of C. maeniata Oberthür, 1896, and the distribution of this species is briefly discussed

Descriptions of Pedesta wangi sp. nov. and the female of P. xiaoqingae (Huang & Zhan, 2004) from China (Lepidoptera: Hesperiidae)

Xue, Guoxi, Li, Meng, Zhu, Jianqing, Lu, Weicheng, Li, Jialing, Zheng, Bowen (2019): Descriptions of Pedesta wangi sp. nov. and the female of P. xiaoqingae (Huang & Zhan, 2004) from China (Lepidoptera: Hesperiidae). Zootaxa 4700 (3): 356-364, DOI: https://doi.org/10.11646/zootaxa.4700.3.