Relationship among medical student resilience, educational environment and quality of life

Resilience is a capacity to face and overcome adversities, with personal transformation and growth. In medical education, it is critical to understand the determinants of a positive, developmental reaction in the face of stressful, emotionally demanding situations. We studied the association among resilience, quality of life (QoL) and educational environment perceptions in medical students. We evaluated data from a random sample of 1,350 medical students from 22 Brazilian medical schools. Information from participants included the Wagnild and Young's resilience scale (RS-14), the Dundee Ready Educational Environment Measure (DREEM), the World Health Organization Quality of Life questionnaire - short form (WHOQOL-BREF), the Beck Depression Inventory (BDI) and the State-Trait Anxiety Inventory (STAI). Full multiple linear regression models were adjusted for sex, age, year of medical course, presence of a BDI score >= 14 and STAI state or anxiety scores >= 50. Compared to those with very high resilience levels, individuals with very low resilience had worse QoL, measured by overall (beta=-0.89; 95% confidence interval =-1.21 to -0.56) and medical-school related (beta=-0.85; 95% CI=-1.25 to -0.45) QoL scores, environment (beta=-6.48; 95% CI=-10.01 to -2.95), psychological (beta=-22.89; 95% CI=-25.70 to -20.07), social relationships (beta=-14.28; 95% CI=-19.07 to -9.49), and physical health (beta=-10.74; 95% CI=-14.07 to -7.42) WHOQOL-BREF domain scores. They also had a worse educational environment perception, measured by global DREEM score (beta=-31.42; 95% CI=-37.86 to -24.98), learning (beta=-7.32; 95% CI=-9.23 to -5.41), teachers (beta=-5.37; 95% CI=-7.16 to -3.58), academic self-perception (beta=-7.33; 95% CI=-8.53 to -6.12), atmosphere (beta=-8.29; 95% CI=-10.13 to -6.44) and social self-perception (beta=-3.12; 95% CI=-4.11 to -2.12) DREEM domain scores. We also observed a dose-response pattern across resilience level groups for most measurements. Medical students with higher resilience levels had a better quality of life and a better perception of educational environment. Developing resilience may become an important strategy to minimize emotional distress and enhance medical training106CONSELHO NACIONAL DE DESENVOLVIMENTO CIENTÍFICO E TECNOLÓGICO - CNPQCOORDENAÇÃO DE APERFEIÇOAMENTO DE PESSOAL DE NÍVEL SUPERIOR - CAPE

Distribuição dos grupos de compatibilidade A1 e A2 de Phytophthora infestans nas regiões sul e sudeste do Brasil.

A requeima, causada por Phytophthora infestans (Straminipila, Oomycota), é a doença mais destrutiva nas culturas de batata e tomate, podendo comprometer a produção em poucos dias. O patógeno é um organismo heterotálico, com dois grupos de compatibilidade A1 e A2, e reprodução assexuada ou sexuada, quando há o encontro de cepas compatíveis, A1 e A2, pelo contato de gametângios com a consequente formação de oósporos. Este trabalho teve como o objetivo monitorar a ocorrência de P. infestans, quanto ao grupo de compatibilidade, em áreas produtoras de batata e tomate das regiões Sul e Sudeste do Brasil. Foram coletadas 31 amostras nos estados de São Paulo, Paraná e Minas Gerais, durante 2015. As amostras foram colocadas em câmara úmida a 16°C com fotoperíodo de 12 h e, após cinco dias, foram observados os sinais do patógeno ao microscópio estereoscópico e óptico. A partir destas amostras foram realizados isolamentos em meio de cultura V8 com a adição de antibióticos e fungicidas. Para a identificação do grupo de compatibilidade de P. infestans, DNA total foi extraído das 31 amostras, submetidos a PCR com os iniciadores W16-1 (5?AACACGCACAAGGCATATAAATGTA -3?) e W16-2 (5?- GCGTAATGTAGCGTAACAGCTCTC -3?) e sequenciados. Trinta isolados de batata e tomate foram pertencentes ao grupo de compatibilidade A1, enquanto que o grupo de compatibilidade A2 foi detectado em apenas uma amostra de tomateiro proveniente do Estado de São Paulo

Evaluation of budesonide-hydroxypropyl-β-cyclodextrin inclusion complex in thermoreversible gels for ulcerative colitis

Background: New formulations for topical treatment of ulcerative colitis with budesonide inclusion complex (BUDHP-β-CD) and poloxamers (PL) were developed for future clinical use. Aims: This study evaluated the efficacy of such novel formulations in a rat model of colitis. Methods: The PL-BUDHP-β-CD systems were prepared by direct dispersion of the complex (BUD concentration 0.5 mg mL−1) in solutions with PL407 or PL403. Male Wistar rats underwent TNBS-induced colitis and were treated for 5 days by a rectal route, as follows: BUD 1: BUDHP-β-CD + PL407 (18%); BUD 2: BUDHP-β-CD + PL407 (20%); BUD 3: BUDHP-β-CD + PL407 (18%) + PL403 (2%); BUD 4: plain BUD; BUD 5: BUDHP-β-CD; C1: HP-β-CD + PL407 (18%); C2: HP-β-CD + PL407 (20%); C3: HP-β-CD + PL407 (18%) + PL403 (2%); C4: saline. A negative control group without colitis was also used. Colitis was assessed via myeloperoxidase (MPO) activity, and macroscopic and microscopic damage score in colon tissues. Protein levels of TNF-α, IL-1β, IL-10 and endogenous glucocorticoids were obtained using ELISA. Results: BUDHP-β-CD poloxamer formulations had similar MPO activity when compared with the negative control group. All formulations presented lower MPO activity than BUDHP-β-CD and plain BUD (p < 0.001). BUD 2 produced lower microscopic score values than plain BUD and BUDHP-β-CD (p < 0.01). All formulations with BUDHP-β-CD poloxamers reduced TNF-α levels (p < 0.05). Conclusion: Novel budesonide inclusion complex formulations improved microscopic damage and reduced colonic MPO activity and TNF-α levels.FUNDAÇÃO DE AMPARO À PESQUISA DO ESTADO DE SÃO PAULO - FAPESP2014/26200-