A homoclinic tangle on the edge of shear turbulence

Experiments and simulations lend mounting evidence for the edge state hypothesis on subcritical transition to turbulence, which asserts that simple states of fluid motion mediate between laminar and turbulent shear flow as their stable manifolds separate the two in state space. In this Letter we describe a flow homoclinic to a time-periodic edge state. Its existence explains turbulent bursting through the classical Smale-Birkhoff theorem. During a burst, vortical structures and the associated energy dissipation are highly localized near the wall, in contrast to the familiar regeneration cycle

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

The peacebuilding potential of technical and vocational education and training programmes in post-conflict Sierra Leone

In peacebuilding contexts unemployed youth are frequently perceived as a high risk for the stability of a country while employed youth are seen as carrying an enormous potential for economic growth. This paper applies a social justice framework (4Rs) in analysing a Business Development (BD) programme that was implemented as part of Sierra Leone’s Technical and Vocational Education and Training (TVET) strategy to promote entrepreneurship development and reduce unemployment among youth. Despite the BD programme’s initial strengths, to recognize youth's heterogeneity with the aim to address some of the root causes of the war, we show how the programme struggled to counter social inequality, unemployment and neopatrimonialism. Sudden decreases in donor funding led to severe modifications of redistribution processes, thereby hampering youth's representation. This raises questions about the design of TVET strategies and BD programmes in post-conflict settings in general. Our paper further showcases how the resurfacing of the root causes of a conflict in the scope of small-scheme development programmes, can have far-reaching effects on young people’s various relationships of trust, if not reconciliation process as a whole

Scales in space

Economists have devoted more attention to the scale of time than to the scale of space. What has been done in the field of space is often general and abstract, not connected to an explicit observation set in time and space. Moreover, time scales and spatial scales are not tied, making the choice for a macro, meso or microeconomic theory a rather arbitrary process. We devote attention to the explanation of the phenomenon of emerging spatial structures. We will discuss the standard economic theories that describe the underlying processes and argue that by being more explicit about spatial scales explanatory power is added to current theoretical work

Are we overusing IVF?

Peer reviewedPublisher PD

Very preterm children at early school age:Studies into assessment, development and support

The aims of this thesis were to unravel unresolved issues in the follow-up of very preterm children, and to provide insight in very preterm children’s support needs and their cognitive, motor and educational development at early school age. Two issues in follow-up described in the current thesis were correcting cognitive scores for prematurity and the effect of multilingualism on cognitive outcomes. Results showed that at the age of five years, there is still a significant difference between corrected and uncorrected IQ scores. Whether and up to what age to correct outcomes for prematurity should depend on the purpose and use of such outcomes. Results showed multilingualism to be negatively associated with cognitive outcomes in two- and five-year-old very preterm children. Exposing preterm children to two different languages at a young age might cause an overload of information, which might negatively affect their overall cognitive development. At preschool age a large proportion (61%) of very preterm children received health care therapies and/or educational support. The high proportion of children receiving support reinforces the idea that we need to have robust data to value the benefits, but also the burden of interventions for children, parents and society. At five years of age, we found that preschool mathematical skills were compromised, which could be explained by their visual-perceptive deficits. At eight years of age our results showed a substantial difference between verbal IQ and performance IQ which underlines the necessity to interpret both components separately