A stochastic-dynamic model for global atmospheric mass field statistics

A model that yields the spatial correlation structure of atmospheric mass field forecast errors was developed. The model is governed by the potential vorticity equation forced by random noise. Expansion in spherical harmonics and correlation function was computed analytically using the expansion coefficients. The finite difference equivalent was solved using a fast Poisson solver and the correlation function was computed using stratified sampling of the individual realization of F(omega) and hence of phi(omega). A higher order equation for gamma was derived and solved directly in finite differences by two successive applications of the fast Poisson solver. The methods were compared for accuracy and efficiency and the third method was chosen as clearly superior. The results agree well with the latitude dependence of observed atmospheric correlation data. The value of the parameter c sub o which gives the best fit to the data is close to the value expected from dynamical considerations

Collective resonances in plasmonic crystals: Size matters

Periodic arrays of metallic nanoparticles may sustain Surface Lattice Resonances (SLRs), which are collective resonances associated with the diffractive coupling of Localized Surface Plasmon Resonances (LSPRs). By investigating a series of arrays with varying number of particles, we traced the evolution of SLRs to its origins. Polarization resolved extinction spectra of arrays formed by a few nanoparticles were measured, and found to be in very good agreement with calculations based on a coupled dipole model. Finite size effects on the optical properties of the arrays are observed, and our results provide insight into the characteristic length scales for collective plasmonic effects: for arrays smaller than 5 x 5 particles, the Q-factors of SLRs are lower than those of LSPRs; for arrays larger than 20 x 20 particles, the Q-factors of SLRs saturate at a much larger value than those of LSPRs; in between, the Q-factors of SLRs are an increasing function of the number of particles in the array.Comment: 4 figure

Tolerance to mutations in the foot-and-mouth disease virus integrin-binding RGD region is different in cultured cells and in vivo and depends on the capsid sequence context.

Engineered RNAs carrying substitutions in the integrin receptor-binding Arg-Gly-Asp (RGD) region of foot-and-mouth disease virus (FMDV) were constructed (aa 141-147 of VP1 capsid protein) and their infectivity was assayed in cultured cells and suckling mice. The effect of these changes was studied in the capsid proteins of two FMDVs, C-S8c1, which enters cells through integrins, and 213hs(-), a derivative highly adapted to cell culture whose ability to infect cells using the glycosaminoglycan heparan sulfate (HS) as receptor, acquired by multiple passage on BHK-21 cells, has been abolished. The capsid sequence context determined infectivity in cultured cells and directed the selection of additional replacements in structural proteins. Interestingly, a viral population derived from a C-S8c1/L144A mutant, carrying only three substitutions in the capsid, was able to expand tropism to wild-type (wt) and mutant (mt)glycosaminoglycan-deficient CHO cells. In contrast, the 213hs(-) capsid tolerated all substitutions analysed with no additional mutations, and the viruses recovered maintained the ability of the 213hs(-) parental virus to infect wt and mt CHO cells. Viruses derived from C-S8c1 with atypical RGD regions were virulent and transmissible for mice with no other changes in the capsid. Substitution of Asp143 for Ala in the C-S8c1 capsid eliminated infectivity in cultured cells and mice. Co-inoculation with a neutralizing monoclonal antibody directed against the type C FMDV RGD region abolished infectivity of C-S8c1 virus on suckling mice, suggesting that FMDV can infect mice using integrins. Sequence requirements imposed for viral entry in vitro and in vivo are discussed

Modelling a two-dimensional spatial distribution of mycotoxin concentration in bulk commodities to design effective and efficient sample selection strategies

Mycotoxins in agricultural commodities are a hazard to human and animal health. Their heterogeneous spatial distribution in bulk storage or transport makes it particularly difficult to design effective and efficient sampling plans. There has been considerable emphasis on identifying the different sources of uncertainty associated with mycotoxin concentration estimations, but much less on identifying the effect of the spatial location of the sampling points. This study used a two-dimensional statistical modelling approach to produce detailed information on appropriate sampling strategies for surveillance of mycotoxins in raw food commodities. The emphasis was on deoxynivalenol (DON) and ochratoxin A (OTA) in large lots of grain in storage or bulk transport. The aim was to simulate a range of plausible distributions of mycotoxins in grain from a set of parameters characterising the distributions. For this purpose, a model was developed to generate data sets which were repeatedly sampled to investigate the effect that sampling strategy and the number of incremental samples has on determining the statistical properties of mycotoxin concentration. Results showed that, for most sample sizes, a regular grid proved to be more consistent and accurate in the estimation of the mean concentration of DON, which suggests that regular sampling strategies should be preferred to random sampling, where possible. For both strategies, the accuracy of the estimation of the mean concentration increased significantly up to sample sizes of 40-60 (depending on the simulation). The effect of sample size was small when it exceeded 60 points, which suggests that the maximum sample size required is of this order. Similar conclusions about the sample size apply to OTA, although the difference between regular and random sampling was small and probably negligible for most sample sizes

Developing Allometric Equations for Teak Plantations Located in the Coastal Region of Ecuador from Terrestrial Laser Scanning Data

Traditional studies aimed at developing allometric models to estimate dry above-ground biomass (AGB) and other tree-level variables, such as tree stem commercial volume (TSCV) or tree stem volume (TSV), usually involves cutting down the trees. Although this method has low uncertainty, it is quite costly and inefficient since it requires a very time-consuming field work. In order to assist in data collection and processing, remote sensing is allowing the application of non-destructive sampling methods such as that based on terrestrial laser scanning (TLS). In this work, TLS-derived point clouds were used to digitally reconstruct the tree stem of a set of teak trees (Tectona grandis Linn. F.) from 58 circular reference plots of 18 m radius belonging to three different plantations located in the Coastal Region of Ecuador. After manually selecting the appropriate trees from the entire sample, semi-automatic data processing was performed to provide measurements of TSCV and TSV, together with estimates of AGB values at tree level. These observed values were used to develop allometric models, based on diameter at breast height (DBH), total tree height (h), or the metric DBH2 × h, by applying a robust regression method to remove likely outliers. Results showed that the developed allometric models performed reasonably well, especially those based on the metric DBH2 × h, providing low bias estimates and relative RMSE values of 21.60% and 16.41% for TSCV and TSV, respectively. Allometric models only based on tree height were derived from replacing DBH by h in the expression DBH2 x h, according to adjusted expressions depending on DBH classes (ranges of DBH). This finding can facilitate the obtaining of variables such as AGB (carbon stock) and commercial volume of wood over teak plantations in the Coastal Region of Ecuador from only knowing the tree height, constituting a promising method to address large-scale teak plantations monitoring from the canopy height models derived from digital aerial stereophotogrammetry

Coherent absorption and enhanced photoluminescence in thin layers of nanorods

We demonstrate a large light absorptance (80%) in a nanometric layer of quantum dots in rods (QRs) with a thickness of 23 nm. This behavior is explained in terms of the coherent absorption by interference of the light incident at a certain angle onto the very thin QR layer. We exploit this coherent light absorption to enhance the photoluminescent emission from the QRs. Up to a seven- and fivefold enhancement of the photoluminescence is observed for p- and s-polarized incident light, respectively.Comment: Physical Review B 201

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed