Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety

Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety

A state-of-the-art review of the chemical composition of sugarcane spirits and current advances in quality control

Financiado para publicación en acceso aberto: Universidade de Vigo/CISUGSugarcane spirits (cachaça) is one of the most traditional drinks in Brazil, being the third most consumed distilled beverage in the world. Chemically, a sugarcane spirit is considered a complex product and, among the production steps, the type of distillation directly influences the chemical composition and sensory characteristics of the product. However, some substances considered undesirable may be present in sugarcane spirits which can pose a risk to human health or decrease the sensory quality of the drink. Sugarcane spirit producers face major challenges, mainly related to the adoption of good production practices, which reflect the loss of quality and lack of standardization of the drink. The use of different instrumental analytical techniques used to identify and quantify the chemical compounds in sugarcane spirit was discussed in this study. Modern chemometric and artificial intelligence tools for data processing were reported, as well as the use of computer vision as a promising strategy in the identification of fraud, adulteration and non-compliance with legislation. Innovative methods are a trend in determining the quality of beverages, considering that most of them are characterized by being simple, fast, relatively low cost, efficient and environmentally correc

Effect of Prebiotics and Synbiotics Carried by Food over Irritable Bowel Syndrome Symptoms: A Systematic Review

Irritable bowel syndrome (IBS) is a chronic condition that affects 11.2% of the world’s population. The management of gut microbiota using probiotic and synbiotic agents might be a valid alternative to assist in the treatment of IBS. The focus of this study was to evaluate the effects of prebiotic and synbiotic compounds carried by different foods on major symptoms of IBS through a systematic literature review. MEDLINE, EMBASE, Cochrane Central Register of Controlled Trials, and LILACS were accessed during July 2021. The studies included in this review were the ones that tested volunteers older than 16 years of age and were conducted using a randomized, controlled clinical trial. The risk of bias was assessed by using the Cochrane risk-of-bias tool for randomized trials (RoB2). Furthermore, the data found were qualitatively evaluated due to the studies’ differences. Two papers were able to fit the criteria, with a total sample size of 280 participants. No datum was found regarding the use of prebiotics in the treatment of IBS. Synbiotic agents, however, had a positive effect on gastrointestinal symptoms and the participants’ overall bowel satisfaction; however, it was not possible to reach a consensus on which effects. Further studies regarding the use of synbiotics and prebiotics must be carried out to determine which effects are the most significant in the treatment of IBS