67 research outputs found
Unravelling molecular mechanisms in the fluorescence spectra of doxorubicin in aqueous solution by femtosecond fluorescence spectroscopy
International audienceDoxorubicin (DOX) is a potent anti-tumoral agent widely used for cancer therapy. Despite numerous studies, the fluorescence properties of DOX, usually exploited for the characterization of the interaction with biological media, have until now led to controversial interpretations, mainly due to self-association of the drug in aqueous solution. We present here the first femtosecond study of DOX based on measurements with the fluorescence up-conversion technique in combination with time-correlated single photon counting using the same laser source. We provide evidence that fluorescence signals of DOX stem from monomers and dimers. DOX dimerization induces a dramatic decrease in the fluorescence quantum yield from 3.9 × 10−2 to 10−5 associated with the red shift of the fluorescence spectrum by [similar]25 nm. While the fluorescence lifetime of the monomer is 1 ns, the dimer fluorescence is found to decay with a lifetime of about 2 ps. In contrast to monomers, the fluorescence anisotropy of dimers is found to be negative. These experimental observations are consistent with an ultrafast internal conversion (<200 fs) between two exciton states, possibly followed by a charge separation process
Long-lived fluorescence of homopolymeric guanine–cytosine DNA duplexes
International audienceThe fluorescence spectrum of the homopolymeric double helix poly(dG)·poly(dC) is dominated by emission decaying on the nanosecond time-scale, as previously reported for the alternating homologue poly(dGdC)·poly(dGdC). Thus, energy trapping over long periods of time is a common feature of GC duplexes which contrast with AT duplexes. The impact of such behaviour on DNA photodamage needs to be evaluated
Optical Properties of Guanine Nanowires: Experimental and Theoretical Study
International audienceLong nanowires formed by ca. 800 guanine tetrads (G4-wires) are studied in phosphate buffer containing sodium cations. Their room temperature optical properties are compared to those of the monomeric chromophore 2-deoxyguanine monophosphate (dGMP). When going from dGMP to G4-wires, both the absorption and the fluorescence spectra change. Moreover, the fluorescence quantum yield increases by a factor of 7.3 whereas the average fluorescence lifetime increases by more than 2 orders of magnitude, indicating emission associated with weakly allowed transitions. The behavior of G4-wires is interpreted in the light of a theoretical study performed in the frame of the exciton theory combining data from molecular dynamics and quantum chemistry. These calculations, carried out for a quadruplex composed of three tetrads, reveal the existence of various exciton states having different energies and oscillator strengths. The degree of delocalization of the quadruplex Franck−Condon excited states is larger than those found for longer duplexes following the same methodology. The slower excited-state relaxation in G4-wires compared to dGMP is explained by emission from exciton states, possibly limited on individual tetrads, whose coherence is reserved by the reduced mobility of guanines due to multiple Hoogsteen hydrogen bonds
Study of the intrinsic fluorescence properties of peculiar DNA structures and their interactions with ligands
International audienc
The effect of size on the optical properties of guanine nanostructures: a femtosecond to nanosecond study
International audienceG-quadruplexes, whose building blocks are guanine tetrads, encounter increasing interest with respect to their potential applications in the field of molecular electronics. Here we study how the size of these nanostructures affects their fluorescence. We compare the properties of thymine capped G-quadruplexes, formed by association of four single DNA strands d(TG(3)T), d(TG(4)T) and d(TG(5)T) and stabilized by K+ ions. We show that an increase in the number of tetrads induces a narrowing of the fluorescence spectrum, an increase in the fluorescence quantum yield, a lengthening of fluorescence lifetime and a decrease of the anisotropy detected on the femtosecond time-scale. The in-plane depolarization of the fluorescence, occurring in less than 1 ps, is attributed to population of Franck-Condon exciton states and ultrafast intraband scattering, leading to energy transfer. The persistence of excitons with partial J-aggregate character on the picosecond time-scale increases with the G-quadruplex size, which enhances the stiffness of the system
Ultrafast Excited-State Deactivation of 8‑Hydroxy-2′-deoxyguanosine Studied by Femtosecond Fluorescence Spectroscopy and Quantum-Chemical Calculations
International audienceThe fluorescence properties of the 8-hydroxy-2′- deoxyguanosine (8-oxo-dG) in aqueous solution at pH 6.5 are studied by steady-state spectroscopy and femtosecond fluorescence up-conversion and compared with those of 2′-deoxyguanine (dG) and 2′-deoxyguanine monophosphate (dGMP). The steady-state fluorescence spectrum of 8-oxo-dG is composed of a broad band that peaks at 356 nm and extends over the entire visible spectral region, and its fluorescence quantum yield is twice that of dG/dGMP. After excitation at 267 nm, the initial fluorescence anisotropy at all wavelengths is lower than 0.1, giving evidence of an ultrafast internal conversion (<100 fs) between the two lowest excited ππ* states (Lb and La). The fluorescence decays of 8-oxo-dG are biexponential with an average lifetime of 0.7 ± 0.1 ps, which is about two times longer than that of dGMP. In contrast with dGMP, only a moderate dynamical shift (∼1400 vs 10 000 cm−1) of the fluorescence spectra of 8-oxo-dG is observed on the time scale of a few picoseconds without modification of the spectral shape. PCM/TD-DFT calculations, employing either the PBE0 or the M052X functionals, provide absorption spectra in good agreement with the experimental one and show that the deactivation path is similar to that proposed for dGMP, with a fast motion toward an energy plateau, where the purine ring keeps an almost planar geometry, followed by decay to S0, via out-of-the plane motion of amino substituent
Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study
International audienceThe present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects
Ultrafast Electron Transfer in Complexes of Doxorubicin with Human Telomeric G-Quadruplexes and GC Duplexes Probed by Femtosecond Fluorescence Spectroscopy
International audienceDoxorubicin (DOX) is a natural anthracycline widely used in chemotherapy; its combined application as a chemotherapeutic and photodynamic agent has been recently proposed. In this context, understanding the photoinduced properties of DOX complexes with nucleic acids is crucial. Herein, the study of photoinduced electron transfer in DOX–DNA complexes by femtosecond fluorescence spectroscopy is reported. The behaviour of complexes with two model DNA structures, a G-quadruplex (G4) formed by the human telomeric sequence (Tel21) and a d(GC) duplex, is compared. The DOX affinity for these two sequences is similar. Although both 1:1 and 2:1 stoichiometries have been reported for DOX–G4 complexes, only 1:1 complexes form with the duplex. The steady-state absorption indicates a strong binding interaction with the duplex due to drug intercalation between the GC base pairs. In contrast, the interaction of DOX with Tel21 is much weaker and arises from drug binding on the G4 external faces at two independent binding sites. As observed for DOX–d(GC) complexes, fluorescence of the drug in the first binding site of Tel21 exhibits decays within a few picoseconds following a biphasic pattern; this is attributed to the existence of two drug conformations. The fluorescence of the drug in the second binding site of Tel21 shows slower decays within 150 ps. These timescales are consistent with electron transfer from the guanines to the excited drug, as favoured by the lower oxidation potential of the stacked guanines of G4 with respect to those in the duplex
- …