The Iran-Iraq conflict : recent developments in the international law of naval engagements

Initial advances into Iranian territory were repulsed and by 1982 Iraq had withdrawn to previously recognised international boundaries. The war on land lapsed into statement with neither side being capable of launching a sufficiently strong offensive to terminate hostilities. Partly in retaliation for Iran's successful blockade of Iraqi shipping and partly in an attempt to cripple Iranian oil exports and undermine the enemy war effort, Iraq expanded the conflict onto the waters of the Persian Gulf. Exclusion zones were declared in the northern Gulf, and shipping calling at the Iranian oil terminal at Kharg Island singled out for unannounced missile attacks. Iraq has hit over 170 tankers in the Gulf war. Iran has made fewer attacks but most of these have occurred outside both the Iranian and Iraqi war zones. Neutral shipping calling at neutral Gulf ports are considered lawful targets for destruction. Recently Kuwaiti-bound' vessels have been hit. Neutral merchant shipping is being stopped and searched at the entrance to the Gulf. The United States, having committed itself to upholding the freedom of neutral navigation in the region, has transferred Kuwaiti tankers to US registration and is escorting the re-flagged vessels to protect them from Iranian interference and attack. The United Nations Security Council has passed Resolutions calling for an end to the hostilities and has denounced attacks on neutral shipping in international waters. No Chapter Vll procedures for collective security enforcement under the Charter have been invoked 6. and not one of the Resolutions is binding

Regulatory processes in the central nervous system: A study of g-protein abundance and of soluble 5'-nucleotidase

The abundance of G-protein α-subunits were measured by quantitative immunoblotting. Hypothyroidism increased the abundance of Gi1α, Gi2α and Goα in synaptosomal membranes from the cerebral cortex and striatum. In the other brain regions some but not all of the G-proteins were up-regulated. In hyperthyroidism the abundance of Gilα and Gi2α were halved in the cerebral cortex after only 3 days treatment with T3. Together these findings may in part contribute to physiological and behaviourial changes seen in thyroid abnormalities. Soluble 5’-nucleotidase (EC 3.1.3.5) was assayed in six regions of the rat brain. ATP inhibited the activity in a complex fashion suggesting the presence of at least two soluble enzymes; one being strongly inhibited and another being ATP activated. The proportions of these two activities varied between brain regions, and activity changes seen in hypothyroidism suggest that they may be independently regulated. The ATP-inhibitable enzyme was purified 1770 fold to apparent homogeneity. It appeared to be a 230kDa glycoprotein composed of 53kDa subunits. The purified enzyme showed activity towards most nucleoside 5’-monophosphates, but not towards their 2’-deoxyribose counterparts. AMP and UMP were preferred substrates and the enzyme had a Km for AMP of 15μM. ADP and ATP were potent inhibitors of enzyme activity, ATP inhibition being of the mixed type with a Ki of 67μM. This ATP inhibition could be reversed by magnesium ions indicating that free ATP was the inhibiting species. In the course of the purification, two enzyme populations were observed which exhibited different ATP and ADP inhibition characteristics. The differences appeared to be due to the presence of an unknown factor which appeared to be bound to a population of the enzyme hence altering its behaviour on ion exchange. Alone, the factor did not affect the enzyme, but did however greatly enhanced its ATP sensitivity. The factor could be stripped off the enzyme and reconstituted back in a saturable manner

Molecular Diagnostic Tools for Nematodes

The phylum of Nematoda is a species‐rich taxonomic group in abundant numbers across a wide range of habitats, including plant and animal pathogens, as well as good environmental health indicators. Morphological observations are of low throughput and more importantly have problems with their discriminatory capacity, particularly at the species level. For these reasons, diagnostic tools are of paramount importance for all fields of human, animal and plant nematology as well as for environmental studies in water and soil. Accurate, fast and low‐cost methodologies are required in order to identify and quantify the population of nematodes in samples from various sources. Scientists in basic research as well as in routine application fields need to have tools for resolving these identification obstacles. Their decisions can be human‐, animal‐ or plant‐health related, while many times legally committing. As a result, applicable and accredited methods are required and should be readily available in a common routine lab or in the field of battle or at border control agencies. This chapter aims to inform with the most current information on the available tools for nematode diagnostics, their positives and negatives and hints about the trends in the field and suggestions for those who would like to pursue further this field of biotechnology as researchers or simple users

Development of a novel PCR based analytical protocol for the characterization of the two variants of prolactin gene that affect milk yield in sheep breeds

Prolactin is a lactogenic hormone which plays a significant role in milk production in mammals, and its depletion in sheep provokes severe reduction of milk secretion. Two different variants within intron 2 of the prolactin gene have been described (A and B) and this polymorphism has been recently proposed as a marker for future breeding schemes in dairy sheep. The present study fully characterized this polymorphism, resulting in a simpler and cost effective PCR-based assay for genetic identification in sheep populations. Up to now, the two variants A and B were identified by their difference in RFLP digestion patterns. This assay, however, is laborious since it requires the generation of a 2.5kb PCR fragment from genomic DNA prior to digestion, which is often difficult to obtain. By sequencing PCR products form AA and BB homozygous animals and performing alignments, we confirmed that the B variant results from a 23bp deletion (sequence: GGTGTTTCTCTTCATAAAGACTC) of the A variant of the prolactin gene. This finding assisted the design of new primers for the identification of prolactin polymorphism based on the size of the PCR product and relinquishes the need of RFLP digestions. Using these developments, we genotyped an experimental flock of 380 Chios breed sheep and carried out association studies. In contrast to other sheep breeds, such as the East Friesian and the Serra da Estela, our preliminary data showed no significant effect of this gene on Chios first lactation milk yield. However, the effects of the prolactin gene merit more investigation

Liposomal delivery of hydrophobic RAMBAs provides good bioavailability and significant enhancement of retinoic acid signalling in neuroblastoma tumour cells

Retinoid treatment is employed during residual disease treatment in neuroblastoma, where the aim is to induce neural differentiation or death in tumour cells. However, although therapeutically effective, retinoids have only modest benefits and suffer from poor pharmacokinetic properties. In vivo, retinoids induce CYP26 enzyme production in the liver, enhancing their own rapid metabolic clearance, while retinoid resistance in tumour cells themselves is considered to be due in part to increased CYP26 production. Retinoic acid metabolism blocking agents (RAMBAs), which inhibit CYP26 enzymes, can improve retinoic acid pharmacokinetics in pre-clinical neuroblastoma models. Here we demonstrate that in cultured neuroblastoma tumour cells, RAMBAs enhance retinoic acid action as seen by morphological differentiation, AKT signalling and suppression of MYCN protein. Although active as retinoid enhancers, these RAMBAs are highly hydrophobic and their effective delivery in humans will be very challenging. Here we demonstrate that such RAMBAs can be loaded efficiently into cationic liposomal particles, where the RAMBAs achieve good bioavailability and activity in cultured tumour cells. This demonstrates the efficacy of RAMBAs in enhancing retinoid signaling in neuroblastoma cells and shows for the first time that liposomal delivery of hydrophobic RAMBAs is a viable approach, providing novel opportunities for their delivery and application in humans

Mechanisms of action for the medium-chain triglyceride ketogenic diet in neurological and metabolic disorders

High-fat, low-carbohydrate diets, known as ketogenic diets, have been used as a non-pharmacological treatment for refractory epilepsy. A key mechanism of this treatment is thought to be the generation of ketones, which provide brain cells (neurons and astrocytes) with an energy source that is more efficient than glucose, resulting in beneficial downstream metabolic changes, such as increasing adenosine levels, which might have effects on seizure control. However, some studies have challenged the central role of ketones because medium-chain fatty acids, which are part of a commonly used variation of the diet (the medium-chain triglyceride ketogenic diet), have been shown to directly inhibit AMPA receptors (glutamate receptors), and to change cell energetics through mitochondrial biogenesis. Through these mechanisms, medium-chain fatty acids rather than ketones are likely to block seizure onset and raise seizure threshold. The mechanisms underlying the ketogenic diet might also have roles in other disorders, such as preventing neurodegeneration in Alzheimer's disease, the proliferation and spread of cancer, and insulin resistance in type 2 diabetes. Analysing medium-chain fatty acids in future ketogenic diet studies will provide further insights into their importance in modified forms of the diet. Moreover, the results of these studies could facilitate the development of new pharmacological and dietary therapies for epilepsy and other disorders

Investigating Genetic Determinants of Plasma Inositol Status in Adult Humans

BACKGROUND: Myo-inositol (MI) is incorporated into numerous biomolecules, including phosphoinositides and inositol phosphates. Disturbance of inositol availability or metabolism is associated with various disorders, including neurological conditions and cancers, while supplemental MI has therapeutic potential in conditions such as depression, polycystic ovary syndrome and congenital anomalies. Inositol status may be influenced by diet, synthesis, transport, utilisation and catabolism. OBJECTIVES: We aimed to investigate potential genetic regulation of circulating MI status and to evaluate correlation of MI concentration with other metabolites. METHODS: Gas chromatography mass spectrometry was used to determine plasma MI concentration of more than 2,000 healthy, young adults (aged 18-28 years) from the Trinity Student Study. Genotyping data was used to test association of plasma MI with SNPs in candidate genes, encoding inositol transporters and synthesising enzymes, and test for genome-wide association. We evaluated potential correlation of plasma MI with D-chiro inositol, glucose and other metabolites by Spearman's rank correlation. RESULTS: Mean plasma MI showed a small but significant difference between males and females (28.5 and 26.9 µM, respectively). Candidate gene analysis revealed several nominally significant associations with plasma MI, most notably for SLC5A11, encoding a sodium-coupled inositol transporter, also known as SMIT2 (sodium-dependent myo-inositol transporter 2). However, these did not survive correction for multiple testing. Subsequent testing for genome-wide association with plasma MI did not identify associations of genome-wide significance (p < 5 × 10-8). However, 8 SNPs exceeded the threshold for suggestive significant association with plasma MI concentration (p < 1 × 10-5), 3 of which were located within or close to genes: MTDH, LAPTM4B and ZP2. We found significant positive correlation of plasma MI concentration with concentration of D-chiro-inositol and several other biochemicals including glucose, methionine, betaine, sarcosine and tryptophan. CONCLUSION: Our findings suggest potential for modulation of plasma MI in young adults by variation in SLC5A11 which is worthy of further investigation

Studi Penghematan Energi Pada Unit Ketel Uap Di Pabrik Gula

This paper presents an energy saving study result conducted in a sugar factory located in the East Java of Indonesia. Formerly, the sugar factory was designed to fulfil their energy demand by using an abundance free energy sources, called “baggase”. However, a fossil fuel consumption (i.e. residue) increased sharply to supply boilers due to the baggase availability was not sufficient. It impacted to the increasing of operational costs. Therefore, an energy saving study for the factory had been an interesting subject. The study proposed to assess boilers performance in the factory to reduce residue consumption. A detail energy audit method was conducted to identify the actual energy consumption, energy losses, and energy saving potential. The study results showed that energy saving potential for the boilers was about 11%. The main energy saving measures was to increase boilers efficiency from 64% to 75%. The study report also included with repairing recommendation for the boilers as well as its techno-economic analysis

Age of red blood cells and mortality in the critically ill

INTRODUCTION: In critically ill patients, it is uncertain whether exposure to older red blood cells (RBCs) may contribute to mortality. We therefore aimed to evaluate the association between the age of RBCs and outcome in a large unselected cohort of critically ill patients in Australia and New Zealand. We hypothesized that exposure to even a single unit of older RBCs may be associated with an increased risk of death. METHODS: We conducted a prospective, multicenter observational study in 47 ICUs during a 5-week period between August 2008 and September 2008. We included 757 critically ill adult patients receiving at least one unit of RBCs. To test our hypothesis we compared hospital mortality according to quartiles of exposure to maximum age of RBCs without and with adjustment for possible confounding factors. RESULTS: Compared with other quartiles (mean maximum red cell age 22.7 days; mortality 121/568 (21.3%)), patients treated with exposure to the lowest quartile of oldest RBCs (mean maximum red cell age 7.7 days; hospital mortality 25/189 (13.2%)) had an unadjusted absolute risk reduction in hospital mortality of 8.1% (95% confidence interval = 2.2 to 14.0%). After adjustment for Acute Physiology and Chronic Health Evaluation III score, other blood component transfusions, number of RBC transfusions, pretransfusion hemoglobin concentration, and cardiac surgery, the odds ratio for hospital mortality for patients exposed to the older three quartiles compared with the lowest quartile was 2.01 (95% confidence interval = 1.07 to 3.77). CONCLUSIONS: In critically ill patients, in Australia and New Zealand, exposure to older RBCs is independently associated with an increased risk of death

Role of CD14+ monocyte-derived oxidised mitochondrial DNA in the inflammatory interferon type 1 signature in juvenile dermatomyositis

OBJECTIVES: To define the host mechanisms contributing to the pathological interferon (IFN) type 1 signature in Juvenile dermatomyositis (JDM). METHODS: RNA-sequencing was performed on CD4+, CD8+, CD14+ and CD19+ cells sorted from pretreatment and on-treatment JDM (pretreatment n=10, on-treatment n=11) and age/sex-matched child healthy-control (CHC n=4) peripheral blood mononuclear cell (PBMC). Mitochondrial morphology and superoxide were assessed by fluorescence microscopy, cellular metabolism by 13C glucose uptake assays, and oxidised mitochondrial DNA (oxmtDNA) content by dot-blot. Healthy-control PBMC and JDM pretreatment PBMC were cultured with IFN-α, oxmtDNA, cGAS-inhibitor, TLR-9 antagonist and/or n-acetyl cysteine (NAC). IFN-stimulated gene (ISGs) expression was measured by qPCR. Total numbers of patient and controls for functional experiments, JDM n=82, total CHC n=35. RESULTS: Dysregulated mitochondrial-associated gene expression correlated with increased ISG expression in JDM CD14+ monocytes. Altered mitochondrial-associated gene expression was paralleled by altered mitochondrial biology, including 'megamitochondria', cellular metabolism and a decrease in gene expression of superoxide dismutase (SOD)1. This was associated with enhanced production of oxidised mitochondrial (oxmt)DNA. OxmtDNA induced ISG expression in healthy PBMC, which was blocked by targeting oxidative stress and intracellular nucleic acid sensing pathways. Complementary experiments showed that, under in vitro experimental conditions, targeting these pathways via the antioxidant drug NAC, TLR9 antagonist and to a lesser extent cGAS-inhibitor, suppressed ISG expression in pretreatment JDM PBMC. CONCLUSIONS: These results describe a novel pathway where altered mitochondrial biology in JDM CD14+ monocytes lead to oxmtDNA production and stimulates ISG expression. Targeting this pathway has therapeutical potential in JDM and other IFN type 1-driven autoimmune diseases