Amphibia, Hylidae, Osteocephalus exophthalmus Smith and Noonan, 2001: new country record and geographic distribution map, Venezuela

Osteocephalus exophthalmus Smith and Noonan is reported from Sierra de Lema in Venezuela, 190 km NW of the type locality in Guyana. This is the first record of the species in Venezuela

Multilocus phylogenetics in a widespread African anuran lineage (Brevicipitidae: Breviceps) reveals patterns of diversity reflecting geoclimatic change

AimTo investigate models assessing the influence of geomorphology and climatic shifts on species diversification in sub‐Saharan Africa by reconstructing the pattern and timing of phylogenetic relationships of rain frogs (Brevicipitidae: Breviceps).LocationSub‐Saharan Africa, south of the Congo Basin.MethodsMultilocus sequence data were generated for near complete species‐level sampling of the genus Breviceps. Phylogenetic relationships were inferred via Bayesian inference and maximum likelihood analyses on both concatenated and single‐gene datasets. Network analyses identified locus‐specific reticulate relationships among taxa. Bayesian methods were used to infer dates of divergence among Breviceps lineages, and niche modelling was used to identify possible adaptive divergence.ResultsBreviceps is monophyletic and comprised of two major, largely allopatric subclades. Diversity within each subclade is concentrated in two areas with contrasting geologic and climatic histories: the arid/semiarid winter rainfall zone in the south‐western (SW) Cape, and the semitropical East Coast that receives predominantly summer rainfall. Recognized species diversity in the SW Cape based on phenotypic variation is consistent with observed genetic patterns whereas the East Coast is shown to harbour unexpectedly high genetic diversity and up to seven putative, cryptic species. Niche models show significant overlap between closely related species.Main conclusionsDating analyses indicate that diversification of Breviceps occurred rapidly within the Miocene, with only a moderate decline over the Plio‐Pleistocene, suggesting that this process might be slowed but ongoing. Our findings suggest that a combination of two models, a landscape barrier model and climate fluctuation model, can explain patterns of diversification in Breviceps. This demonstrates that Miocene epeirogenic events and climatic shifts may have had a considerable influence on contemporary patterns of biodiversity. Topographic complexity and relative geoclimatic stability in the East have promoted cryptic diversification in allopatry, and this area clearly harbours numerous undescribed taxa and is in need of detailed biotic investigation.Peer Reviewedhttps://deepblue.lib.umich.edu/bitstream/2027.42/145569/1/jbi13394.pdfhttps://deepblue.lib.umich.edu/bitstream/2027.42/145569/2/jbi13394_am.pd

Cancer evolution: mathematical models and computational inference.

Cancer is a somatic evolutionary process characterized by the accumulation of mutations, which contribute to tumor growth, clinical progression, immune escape, and drug resistance development. Evolutionary theory can be used to analyze the dynamics of tumor cell populations and to make inference about the evolutionary history of a tumor from molecular data. We review recent approaches to modeling the evolution of cancer, including population dynamics models of tumor initiation and progression, phylogenetic methods to model the evolutionary relationship between tumor subclones, and probabilistic graphical models to describe dependencies among mutations. Evolutionary modeling helps to understand how tumors arise and will also play an increasingly important prognostic role in predicting disease progression and the outcome of medical interventions, such as targeted therapy.FM would like to acknowledge the support of The University of Cambridge, Cancer Research UK and Hutchison Whampoa Limited.This is the final published version. It first appeared at http://sysbio.oxfordjournals.org/content/early/2014/10/07/sysbio.syu081.short?rss=1

Cryptic diversity among Yazoo Darters (Percidae: Etheostoma raneyi) in disjunct watersheds of northern Mississippi

© Copyright 2020 Nasser et al. The Yazoo Darter, Etheostoma raneyi (Percidae), is an imperiled freshwater fish species endemic to tributaries of the Yocona and Little Tallahatchie rivers of the upper Yazoo River basin, in northern Mississippi, USA. The two populations are allopatric, isolated by unsuitable lowland habitat between the two river drainages. Relevant literature suggests that populations in the Yocona River represent an undescribed species, but a lack of data prevents a thorough evaluation of possible diversity throughout the range of the species. Our goals were to estimate phylogenetic relationships of the Yazoo Darter across its distribution and identify cryptic diversity for conservation management purposes. Maximum likelihood (ML) phylogenetic analyses of the mitochondrial cytochrome b (cytb) gene returned two reciprocally monophyletic clades representing the two river drainages with high support. Bayesian analysis of cytb was consistent with the ML analysis but with low support for the Yocona River clade. Analyses of the nuclear S7 gene yielded unresolved relationships among individuals in the Little Tallahatchie River drainage with mostly low support, but returned a monophyletic clade for individuals from the Yocona River drainage with high support. No haplotypes were shared between the drainages for either gene. Additional cryptic diversity within the two drainages was not indicated. Estimated divergence between Yazoo Darters in the two drainages occurred during the Pleistocene (\u3c1 million years ago) and was likely linked to repeated spatial shifts in suitable habitat and changes in watershed configurations during glacial cycles. Individuals from the Yocona River drainage had lower genetic diversity consistent with the literature. Our results indicate that Yazoo Darters in the Yocona River drainage are genetically distinct and that there is support for recognizing Yazoo Darter populations in the Yocona River drainage as a new species under the unified species concept

Amphibia, Bufonidae, Didynamipus sjostedti Andersson, 1903: new records and a review of geographic distribution

Didynamipus sjostedti is reported from two new sites in southwest Cameroon. The distribution of this species is discussed with a review of known specimen

Linking Predator Responses to Alkaloid Variability in Poison Frogs Language:

Many chemically-defended/aposematic species rely on diet for sequestering the toxins with which they defend themselves. This dietary acquisition can lead to variable chemical defenses across space, as the community composition of chemical sources is likely to vary across the range of (an aposematic) species. We characterized the alkaloid content of two populations of the Dyeing Poison Frog (Dendrobates tinctorius) in northeastern French Guiana. Additionally, we conducted unpalatability experiments with naive predators, Blue Tits (Cyanistes caeruleus), using whole-skin secretion cocktails to assess how a model predator would respond to the defense of individuals from each population. While there was some overlap between the two D. tinctorius populations in terms of alkaloid content, our analysis revealed that these two populations are markedly distinct in terms of overall alkaloid profles. Predator responses to skin secretions difered between the populations. We identifed 15 candidate alkaloids (including three previously undescribed) in seven classes that are correlated with predator response in one frog population. We describe alkaloid profle diferences between populations for D. tinctorius and provide a novel method for assessing unpalatability of skin secretions and identifying which toxins may contribute to the predator response. In one population, our results suggest 15 alkaloids that are implicated in predator aversive response. This method is the frst step in identifying the causal link between alkaloids and behavioral responses of predators, and thus makes sense of how varying alkaloid combinations are capable of eliciting consistent behavioral responses, and eventually driving evolutionary change in aposematic characters (or characteristics)

A new genus of Cophomantini, with comments on the taxonomic status of Boana liliae (Anura: Hylidae)

© 2018 The Linnean Society of London The non-monophyly of both the genus Myersiohyla and the Boana punctata group has been recovered in a number of published phylogenetic analyses. In this paper we report on the analysis of sequences of Boana liliae, a species originally assigned to the B. punctata group, in a dataset of Cophomantini that recovered novel phylogenetic relationships for this hylid tribe. Our results reveal Myersiohyla to be paraphyletic with respect to B. liliae. Support for the placement of Myersiohyla kanaima is poor, but this taxon is recovered as the sister taxon of the other Cophomantini genera (excluding Myersiohyla) or as the sister taxon of the remaining species of Myersiohyla (including B. liliae). These results lead us to propose two taxonomic changes in order to remedy the paraphyly of Myersiohyla: (1) a new genus is described for M. kanaima, and (2) Boana liliae is transferred to Myersiohyla. We further provide notes on the natural history and vocalizations of the new monotypic genus, a new diagnosis of the former B. liliae in the context of Myersiohyla, and discuss the evolution of tadpole morphology and biogeography of the earlier diverging clades of Cophomantini

Amphibia, Hylidae, Osteocephalus exophthalmus Smith and Noonan, 2001: new country record and geographic distribution map, Venezuela

Osteocephalus exophthalmus Smith and Noonan is reported from Sierra de Lema in Venezuela, 190 km NW of the type locality in Guyana. This is the first record of the species in Venezuela

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer