Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

A flavoprotein supports cell wall properties in the necrotrophic fungus Alternaria brassicicola

Background Flavin-dependent monooxygenases are involved in key biological processes as they catalyze a wide variety of chemo-, regio- and enantioselective oxygenation reactions. Flavoprotein monooxygenases are frequently encountered in micro-organisms, most of which require further functional and biocatalytic assessment. Here we investigated the function of the AbMak1 gene, which encodes a group A flavin monooxygenase in the plant pathogenic fungus Alternaria brassicicola, by generating a deficient mutant and examining its phenotype. Results Functional analysis indicates that the AbMak1 protein is involved in cell wall biogenesis and influences the melanization process. We documented a significant decrease in melanin content in the Δabmak1 strain compared to the wild-type and complemented strains. We investigated the cell wall morphology and physical properties in the wild-type and transformants using electron and atomic force microscopy. These approaches confirmed the aberrant morphology of the conidial wall structure in the Δabmak1 strain which had an impact on hydrophilic adhesion and conidial surface stiffness. However, there was no significant impairment in growth, conidia formation, pathogenicity or susceptibility to various environmental stresses in the Δabmak1 strain. Conclusion This study sheds new light on the function of a fungal flavin-dependent monooxygenase, which plays an important role in melanization

Role of dynamic Jahn-Teller distortions in Na2C60 and Na2CsC60 studied by NMR

Through 13C NMR spin lattice relaxation (T1) measurements in cubic Na2C60, we detect a gap in its electronic excitations, similar to that observed in tetragonal A4C60. This establishes that Jahn-Teller distortions (JTD) and strong electronic correlations must be considered to understand the behaviour of even electron systems, regardless of the structure. Furthermore, in metallic Na2CsC60, a similar contribution to T1 is also detected for 13C and 133Cs NMR, implying the occurence of excitations typical of JT distorted C60^{2-} (or equivalently C60^{4-}). This supports the idea that dynamic JTD can induce attractive electronic interactions in odd electron systems.Comment: 3 figure

Important role of alkali atoms in A4C60

We show that hopping via the alkali atoms plays an important role for the t1u band of A4C60 (A=K, Rb), in strong contrast to A3C60. Thus the t1u band is broadened by more than 40 % by the presence of the alkali atoms. The difference between A4C60 and A3C60 is in particular due to the less symmetric location of the alkali atoms in A4C60.Comment: 5 pages, revtex, 2 figures, submitted to Phys. Rev. B more information at http://www.mpi-stuttgart.mpg.de/dokumente/andersen/fullerene

Vibrational Study of 13C-enriched C60 Crystals

The infrared (IR) spectrum of solid C60 exhibits many weak vibrational modes. Symmetry breaking due to 13C isotopes provides a possible route for optically activating IR-silent vibrational modes. Experimental spectra and a semi-empirical theory on natural abundance and 13C-enriched single crystals of C60 are presented. By comparing the experimental results with the theoretical results, we exclude this isotopic activation mechanism from the explanation for weakly active fundamentals in the spectra.Comment: Accepted for Phys. Rev. B, typeset in REVTEX v3.0 in LaTeX. Postscript file including figures is available at http://insti.physics.sunysb.edu/~mmartin/papers/c13twocol2.ps File with figures will be e-mailed by reques

Gaps and excitations in fullerides with partially filled bands : NMR study of Na2C60 and K4C60

We present an NMR study of Na2C60 and K4C60, two compounds that are related by electron-hole symmetry in the C60 triply degenerate conduction band. In both systems, it is known that NMR spin-lattice relaxation rate (1/T1) measurements detect a gap in the electronic structure, most likely related to singlet-triplet excitations of the Jahn-Teller distorted (JTD) C60^{2-} or C60^{4-}. However, the extended temperature range of the measurements presented here (10 K to 700 K) allows to reveal deviations with respect to this general trend, both at high and low temperatures. Above room temperature, 1/T1 deviates from the activated law that one would expect from the presence of the gap and saturates. In the same temperature range, a lowering of symmetry is detected in Na2C60 by the appearance of quadrupole effects on the 23Na spectra. In K4C60, modifications of the 13C spectra lineshapes also indicate a structural modification. We discuss this high temperature deviation in terms of a coupling between JTD and local symmetry. At low temperatures, 1/T$_1$T tends to a constant value for Na2C60, both for 13C and 23Na NMR. This indicates a residual metallic character, which emphasizes the proximity of metallic and insulting behaviors in alkali fullerides.Comment: 12 pages, 13 figure

Surprises in the Orbital Magnetic Moment and g-Factor of the Dynamic Jahn-Teller Ion C_{60}^-

We calculate the magnetic susceptibility and g-factor of the isolated C_{60}^- ion at zero temperature, with a proper treatment of the dynamical Jahn-Teller effect, and of the associated orbital angular momentum, Ham-reduced gyromagnetic ratio, and molecular spin-orbit coupling. A number of surprises emerge. First, the predicted molecular spin-orbit splitting is two orders of magnitude smaller than in the bare carbon atom, due to the large radius of curvature of the molecule. Second, this reduced spin-orbit splitting is comparable to Zeeman energies, for instance, in X-band EPR at 3.39KGauss, and a field dependence of the g-factor is predicted. Third, the orbital gyromagnetic factor is strongly reduced by vibron coupling, and so therefore are the effective weak-field g-factors of all low-lying states. In particular, the ground-state doublet of C_{60}^- is predicted to show a negative g-factor of \sim -0.1.Comment: 19 pages RevTex, 2 postscript figures include

Far-infrared study of the Jahn-Teller distorted C60 monoanion in C60 tetraphenylphosphoniumiodide

We report high-resolution far-infrared transmission measurements on C(60)-tetraphenylphosphoniumiodide as a function of temperature. In the spectral region investigated (20-650 cm(-1)), we assign intramolecular modes of the C(60) monoanion and identify low-frequency combination modes. The well-known F(1u)(1) and F(1u)(2) modes are split into doublers at room temperature, indicating a D(5d) or D(3d) distorted ball. This result is consistent with a dynamic Jahn-Teller effect in the strong-coupling limit or with a static distortion stabilized by low-symmetry perturbations. The appearance of silent odd modes is in keeping with symmetry reduction of the hall, while activation of even modes is attributed to interband electron-phonon coupling and orientational disorder in the fulleride salt. Temperature dependences reveal a weak transition in the region 125-150 K in both C(60)(-) and counterion modes, indicating a bulk, rather than solely molecular, effect. Anomalous softening (with decreasing temperature) in several modes may correlate with the radial character of those vibrations. [S0163-1829(98)03245-7]

A multiplex-PCR assay for identification of the quarantine plant pathogen Xanthomonas axonopodis pv. phaseoli

In this study we developed an algorithm to screen for all exact molecular signatures of the quarantine pathogen Xanthomonas axonopodis pv. phaseoli (Xap), based on available data of the presence or absence of virulence-associated genes. The simultaneous presence of genes avrBsT and xopL is specific to Xap. Therefore we developed a multiplex PCR assay targeting avrBsT and xopL for the molecular identification of Xap. The specificity of this multiplex was validated by comparison to that of other molecular identification assays aimed at Xap, on a wide collection of reference strains. This multiplex was further validated on a blind collection of Xanthomonas isolates for which pathogenicity was assayed by stem wounding and by dipping leaves into calibrated inocula. This multiplex was combined to the previously described X4c/X4e molecular identification assay for Xap. Such a combination enables the molecular identification of all strains of Xanthomonas pathogenic on bean. Results also show that assay by stem wounding does not give reliable results in the case of Xap, and that pathogenicity assays by dipping should be preferred