Co-thought gestures in children\u27s mental problem solving: Prevalence and effects on subsequent performance

Co‐thought gestures are understudied as compared to co‐speech gestures yet, may provide insight into cognitive functions of gestures that are independent of speech processes. A recent study with adults showed that co‐thought gesticulation occurred spontaneously during mental preparation of problem solving. Moreover, co‐thought gesturing (either spontaneous or instructed) during mental preparation was effective for subsequent solving of the Tower of Hanoi under conditions of high cognitive load (i.e., when visual working memory capacity was limited and when the task was more difficult). In this preregistered study (https://osf.io/dreks/), we investigated whether co‐thought gestures would also spontaneously occur and would aid problem‐solving processes in children (N = 74; 8-12 years old) under high load conditions. Although children also spontaneously used co‐thought gestures during mental problem solving, this did not aid their subsequent performance when physically solving the problem. If these null results are on track, co‐thought gesture effects may be different in adults and children

Heterotrimeric G-protein, Gα16, is a critical downstream effector of non-canonical Wnt signaling and a potent inhibitor of transformed cell growth in non small cell lung cancer.

G-protein-coupled receptors (GPCR) are the largest family of cell surface molecules that play important role/s in a number of biological and pathological processes including cancers. Earlier studies have highlighted the importance of Wnt7a signaling via its cognate receptor Frizzled9, a GPCR, in inhibition of cell proliferation, anchorage-independent growth, and reversal of transformed phenotype in non small cell lung cancer primarily through activation of the tumor suppressor, PPARγ. However, the G-protein effectors that couple to this important tumor suppressor pathway have not been identified, and are of potential therapeutic interest. In this study, by using two independent Wnt7a/Frizzled9-specific read-outs, we identify Gα16 as a novel downstream effector of Wnt7a/Frizzled9 signaling. Interestingly, Gα16 expression is severely down-regulated, both at the messenger RNA levels and protein levels, in many non small cell lung cancer cell lines. Additionally, through gene-specific knock-downs and expression of GTPase-deficient forms (Q212L) of Gα16, we also establish Gα16 as a novel regulator of non small cell lung cancer cell proliferation and anchorage-independent cell growth. Taken together, our data not only establish the importance of Gα16 as a critical downstream effector of the non-canonical Wnt signaling pathway but also as a potential therapeutic target for the treatment of non small cell lung cancer

Heterotrimeric G-Protein, Galpha16, Is a Critical Downstream Effector of Non-Canonical Wnt Signaling and a Potent Inhibitor of Transformed Cell Growth in Non Small Cell Lung Cancer

G-protein-coupled receptors (GPCR) are the largest family of cell surface molecules that play important role/s in a number of biological and pathological processes including cancers. Earlier studies have highlighted the importance of Wnt7a signaling via its cognate receptor Frizzled9, a GPCR, in inhibition of cell proliferation, anchorage-independent growth, and reversal of transformed phenotype in non small cell lung cancer primarily through activation of the tumor suppressor, PPARgamma. However, the G-protein effectors that couple to this important tumor suppressor pathway have not been identified, and are of potential therapeutic interest. In this study, by using two independent Wnt7a/Frizzled9-specific read-outs, we identify Galpha16 as a novel downstream effector of Wnt7a/Frizzled9 signaling. Interestingly, Galpha16 expression is severely down-regulated, both at the messenger RNA levels and protein levels, in many non small cell lung cancer cell lines. Additionally, through gene-specific knock-downs and expression of GTPase-deficient forms (Q212L) of Galpha16, we also establish Galpha16 as a novel regulator of non small cell lung cancer cell proliferation and anchorage-independent cell growth. Taken together, our data not only establish the importance of Galpha16 as a critical downstream effector of the non-canonical Wnt signaling pathway but also as a potential therapeutic target for the treatment of non small cell lung cancer

G_α16 expression is lost in NSCLC.

<p>A, Real-time PCR analyses of the expression of G_α16 in non-transformed and NSCLC cell lines. Total RNA was extracted from a non-transformed cell line (Beas2B) or NSCLC cell lines (H157, H2122, A549, H661 and H1299) and G_α16 expression was quantified using the sense: caccacgctagcctggtcatg and anti-sense: gcgcccttcttgctgccctcggg primers. β-actin was used as an internal control for normalization. Data represents mean ± SEM of three separate experiments performed in duplicates. ^##, <i>p</i><0.01; versus control (Beas2B). B, Western blot analysis of G_α16 expression in non-transformed and NSCLC cell lines. Equal amounts of total cell lysates of a non-transformed cell line (Beas2B) or NSCLC cell lines (H157, H2122, A549, H661 and H1299) were separated on a SDS-PAGE gels, transferred onto nitrocellulose blots and the “blots” were later probed with either anti-G_α16, anti-G_αo or anti-β-actin antibodies.</p

Wnt7a/Fzd9 signaling regulates ROR1/2 expression.

<p>A, H157 and H1299 cells were either transfected with empty vector or with Wnt7a and Fzd9 expression vectors. After 48-β-actin antibodies. H157 cells were transfected with either empty vector or Wnt7a and Fzd9 expression vectors along with either M50-TOPFLASH luciferase reporter (B) or PPAR-RE-luciferase reporter (C). Positive controls used in M50-TOPFLASH reporter experiments is the β-catenin expression vector and in the case of PPAR-RE-luciferase vector is the PPARγ expression vector. After 48 h, the lysates were assayed for luciferase activities as described in the Methods. Data represents mean ± SEM of three separate experiments. **, <i>p</i><0.01; versus empty vector control.</p

G_α16 regulates Wnt7a/Fzd9-mediated ERK5 activation.

<p>A, Beas2B cells were serum starved for 2-PAGE gels and later probed for ERK5 activation by probing the nitrocellulose blots with anti-pERK5 antibodies and normalized for equal loading by probing with anti-ERK5 antibodies. B, Beas2B cells were transfected either with control siRNA or G_α16-specific siRNAs together with or without Wnt7a expression vector. After 48 h, the cells were lysed and analyzed for ERK5 activation by probing the blots with anti-pERK5 and ERK5 antibodies. NSCLC cell lines, H157 (C) or H2122 (D) cells were transfected either with empty vector or G_α16Q212L together with MEF2-C-dependent luciferase reporter, followed by a treatment either without or with MEK inhibitor PD98059 (20 µM). After 24 h, the lysates were assayed for luciferase activities as described in the Methods. Data represents mean ± SEM of three separate experiments. **, <i>p</i><0.01; versus empty vector control. ^##, <i>p</i><0.01; versus G_α16 Q212L.</p

G_α16 regulates NSCLC cell proliferation.

<p>A. Beas2B cells were transfected with either control siRNA or siRNAs specific to G_α16 or G_αo. Total RNA was isolated and analyzed for the expression of G_α16 or G_αo using quantitative PCR. Normalized G_α16 or G_αo mRNA levels to that of β-actin mRNA were represented in the graphs. ^##, <i>p</i><0.01; versus control siRNA. Beas2B cells were transfected with either control siRNA or siRNAs-specific to G_α16 or G_αo and cell proliferation rates were later determined either by using a clonogenic assay (B) or an MTS assay (C) as described in the Methods. Upper panel represents mean ± SEM from two independent highly reproducible experiments, while representative images were displayed in the lower panel. Data represents mean ± SEM from three independent highly reproducible experiments. *, <i>p</i><0.05; **, <i>p</i><0.01; versus control siRNA. H2122 cells were transfected either with empty vector or constitutively active G_α16Q212L or G_αoQ205L expression vectors and the cell proliferation rates were later determined using either a clonogenic assay (D), an MTS assay (E) or five-day cell growth curve analysis (F) as described in the Methods. Upper panel represents mean ± SEM from two independent highly reproducible experiments, while representative images were displayed in the lower panel. Data represents mean ± SEM from three independent highly reproducible experiments. ^#, <i>p</i><0.05; G, H2122 cells were transfected with either empty vector or constitutively active G_α16 Q212L and the abilities of the transfected cells to grow on soft agar were later probed. Data represents mean ± SEM from three independent highly reproducible experiments. ^##, <i>p</i><0.01; versus empty vector control.</p

G_α16 regulates Wnt7a/Fzd9-mediated PPARγ activation.

<p>NSCLC cell lines, H157 (A) or H2122 (B) cells were transfected either with control siRNA or G_α16-specific siRNAs together with PPAR-RE-luciferase reporter and either without or with Wnt7a expression vector. After 48 h, the lysates were assayed for luciferase activities as described in the Methods. Data represents mean ± SEM of three separate experiments. **, <i>p</i><0.01; versus empty vector control. ^##, <i>p</i><0.01; versus Wnt7a. NSCLC cell lines, H157 (C) or H2122 (D) cells were transfected either with empty vector or constitutively active G_α16 Q212L or G_αo Q205L expression vectors together with PPAR-RE-luciferase reporter. After 48 h, the lysates were assayed for luciferase activities as described in the Methods. Data represents mean ± SEM of three separate experiments. **, <i>p</i><0.01; versus empty vector control. NSCLC cell lines, H157 (E) or H2122 (F) were transfected with either empty vector or constitutively active G_α16Q212L. After 24 h, the cells were treated either with or without PPARγ inhibitor (T0070907, 10 µM) as described in the Methods. Cell proliferation rates were later determined using an MTS assay as described in the Methods. Data represents mean ± SEM from three independent highly reproducible experiments. ^##, <i>p</i><0.01; versus empty vector control. **, <i>p</i><0.01; versus G_α16 Q212L+T007090.</p

Identification of G_α16 as a novel downstream regulator of Wnt7a/Fzd9 signaling.

<p>Effects of constitutively active G_α subunits on Wnt7a/Fzd9-dependent read-outs. NSCLC cell lines, H157 (A) or H2122 (B) were transfected either with empty vector, or constitutively active G_α subunits of G-proteins together with PPAR-RE-luciferase reporter and CMV-β-galactosidase reporter vectors. After 48 h, the cells were lysed and luciferase activities were measured as described in the Methods. NSCLC cell lines, H157 (C) or H2122 (D) were transfected either with empty vector, or constitutively active G_α subunits of G-proteins together with E-cadherin promoter-luciferase-reporter and CMV-β-galactosidase reporter vectors. After 48 h, the cells were lysed and luciferase activities were measured as described in the Methods. Luciferase values were normalized to CMV-β-galactosidase values and were represented in the graph. Constitutively active G_α subunit-induced PPRE-dependent gene transcription or E-cadherin promoter activity were represented as the fold change over the empty vector control. Data represents mean ± SEM of three separate experiments. **, <i>p</i><0.01; versus empty vector control.</p