251 research outputs found
Comparison of Prioritisation Schemes for Human Pharmaceuticals in the Aquatic Environment
Only a small proportion of pharmaceuticals available for commercial use have been monitored in the aquatic environment, and even less is known about the effects on organisms. With thousands of pharmaceuticals in use, it is not feasible to monitor or assess the effects of all of these compounds. Prioritisation schemes allow the ranking of pharmaceuticals based on their potential as environmental contaminants, allowing resources to be appropriately used on those which are most likely to enter the environment and cause greatest harm. Many different types of prioritisation schemes exist in the literature and those utilising predicted environmental concentrations (PECs), the fish plasma model (FPM), critical environmental concentrations (CECs) and acute ecotoxicological data were assessed in the current study using the 50 most prescribed drugs in the UK. PECs were found to be overestimates of mean measured environmental concentrations but mainly underestimations of maximum concentrations. Acute ecological data identified different compounds of concern to the other effects assessments although the FPM and CECs methods were more conservative. These schemes highlighted antidepressants, lipid regulators, antibiotics, antihypertensive compounds and ibuprofen as priority compounds for further study and regulation
Spatial and temporal occurrence of pharmaceuticals in UK estuaries
There is a lack of data on the occurrence of pharmaceuticals in estuaries worldwide, with little understanding of their temporal and spatial variations globally. Ibuprofen, paracetamol, diclofenac, trimethoprim and citalopram were measured in twelve estuaries in the UK. Initially, these compounds were monitored in the Humber Estuary, where samples were taken every two months over a twelve month period in order to assess their spatial and temporal variations. Ibuprofen was found at some of the highest concentrations ever measured in an estuary globally (18–6297 ng l−1), with paracetamol also measured at relatively high concentrations (4–917 ng l−1) in comparison to the other compounds. In terms of spatial distribution, a pattern was observed where the highest concentrations were found at a site at which wastewater is discharged, whilst compound concentrations were often lower upstream and downstream of this site. The downstream profile of pharmaceuticals differed temporally with concentrations highest downstream when input from wastewater effluent was highest. Eleven further estuaries were sampled around the UK in order to put the occurrence of pharmaceuticals in the Humber Estuary into a wider context. Pharmaceutical concentrations in the other estuaries sampled were <210 ng l−1 but, again, ibuprofen and paracetamol were found at concentrations higher than other compounds, whereas diclofenac and citalopram were absent in many estuaries. The Humber, which is the receiving environment for the sewage effluent of approximately 20% (13.6 million people) of the population of England, was observed to have the highest overall concentration of pharmaceuticals in contrast to the other estuaries sampled, thereby representing a worst case scenario for pharmaceutical pollution
Genetic deletion of α7 nAChRs reduces hippocampal granule and pyramidal cell number in both sexes but impairs pattern separation in males only
IntroductionNeurogenesis within the dentate gyrus is thought to play an important role in cognitive processes such as reversal learning and pattern separation. The α7 nicotinic acetylcholine receptor (α7 nAChR) is expressed early in newly formed granule cells of the dentate gyrus, though its role in neurogenesis and related cognitive function is not fully understood.MethodsTo better characterize relevant function of α7 nAChRs, we performed unbiased stereology to quantify hippocampal granule cells, pyramidal cells, and total volume and used a touchscreen operant spatial discrimination/reversal task to test pattern separation in a global α7 nAChR knockout mouse line.ResultsThe knockout resulted in an ≈22% reduction in granule cells and a ≈ 20% reduction in pyramidal cells in both sexes, with no change in total hippocampal volume. However, the knockout impaired performance in the touchscreen task for males only. The sex-dependent difference in behavioral, but not stereological, results suggest a divergence in the structure–function relationship in males versus females. Detailed analyses revealed males were more biased by the initial reversal contingency relative to females indicating a potential source of the sex-specific interaction with the loss of α7 nAChRs.DiscussionThese findings argue that the α7 nAChR plays a critical role in hippocampal development, not just granule cell neurogenesis, and plays a sex-dependent role in cognitive function
An Alternative Approach to Aldol Reactions: Gold-Catalyzed Formation of Boron Enolates from Alkynes
Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.
Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates
Synthesis and properties of oligonucleotides containing aminodeoxythymidine units.
Procedures are described for synthesis via solid support methodology of oligonucleotide analogues derived in part from 3'-amino-3'-deoxythymidine or 5'-amino-5'-deoxythymidine. Oligothymidylate decamers terminated with a 3'-amino group or containing a 3'-NHP(O)(O-)O-5' internucleoside link are found to form unusually stable complexes with poly(dA), poly(A), and oligo(dA). For related derivatives of 5'-amino-5'-deoxythymidine enhancement is less or absent, and in the case of multiple substitution destabilization of the heteroduplex may be observed. That the effect of the 3'-amino group is general for oligonucleotide derivatives is indicated by enhanced Tm values for heteroduplex complexes of the mixed-base oligomer, d(TATTCAGTCAT(NH2)), and the methyl phosphonate derivatives, TmTmTmTmTmTmTmTmTmT(NH2) and d(TmAmTmTmCmAmGmTmCmAmT(NH2))
Selective O-phosphitilation with nucleoside phosphoramidite reagents.
In contrast to tetrazole, pyridine hydrochloride/imidazole converts nucleoside phosphoramidites to intermediates that show a high preference for phosphitilating hydroxyl groups relative to nucleoside amino groups. Use of this activating agent and incorporation of a pyridine hydrochloride/aniline wash step in the synthetic cycles permit synthesis of mixed base twenty-mer oligonucleotides from nucleoside reagents containing unprotected amino groups. This approach should be useful for the synthesis of oligonucleotide analogues containing substituents sensitive to reagents used in conventional deblocking steps. Pyridine hydrochloride itself is an effective reagent for activating nucleoside methylphosphonoamidites and ribonucleoside phosphoramidites, as well as deoxyribonucleoside phosphoramidites, when high O/N selectivety is not needed
- …