Structural studies reveal the enantiospecific recognition of a DNA G-quadruplex by a ruthenium polypyridyl complex

Using X-ray crystallography, we show an enantiospecificity in DNA G-quadruplex binding, using the complexes Λ/∆-[Ru(TAP)2(dppz-11-CN)]2+ (TAP=1,4,5,8-tetraazaphenanthrene) containing the dppz (dipyridophenazine) ligand, paralleling the specificity of the complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5’ end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2(11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex forming sequence, and use both structural models to aid in the elucidation of the motif-specific luminescence response of the isostructural phen analogue enantiomers

Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, con-sistent with its transient formation in live cells. The stabilisation of a particular topology by a small molecule is of great importance for therapeutic applications. Here we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays en-antiospecific G-quadruplex binding. It crystallised in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterised example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a compar-ative ligand binding study, we showed, using a Klenow fragment assay, that the title complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work

Molecular adaptations of adipose tissue to 6 weeks of morning fasting vs. daily breakfast consumption in lean and obese adults

This study assessed molecular responses of human subcutaneous abdominal adipose tissue (SCAT) to 6 weeks of morning fasting. Forty‐nine healthy lean (n = 29) and obese (n = 20) adults provided SCAT biopsies before and after 6 weeks of morning fasting (FAST; 0 kcal until 12.00 h) or daily breakfast consumption (BFAST; ≥700 kcal before 11.00 h). Biopsies were analysed for mRNA levels of selected genes, and GLUT4 and Akt protein content. Basal and insulin‐stimulated Akt activation and tissue glucose uptake rates were also determined. In lean individuals, lipid turnover and insulin signalling genes (ACADM and IRS2) were up‐regulated with FAST versus BFAST (ACADM: 1.14 (95% CI: 0.97–1.30) versus 0.80 (95% CI: 0.64–0.96), P = 0.007; IRS2: 1.75 (95% CI: 1.33–2.16) versus 1.09 (95% CI: 0.67–1.51), P = 0.03, respectively). In obese individuals, no differential (FAST versus BFAST) expression was observed in genes involved in lipid turnover (all P > 0.1). GLUT4, Akt protein content and insulin‐stimulated Akt phosphorylation were unaffected by FAST versus BFAST in both lean and obese cohorts (all P > 0.1). Lower insulin‐stimulated glucose uptake rates in obese versus lean individuals were eradicated when normalised to whole‐body fat mass (P = 0.416). We conclude that morning fasting up‐regulates lipid turnover genes in SCAT of lean individuals. Secondly, altered SCAT insulin sensitivity with morning fasting is unlikely to be explained by signalling proximal to Akt. Finally, lower insulin‐stimulated SCAT glucose uptake rates in obese individuals are proportional to whole‐body fat mass, suggesting a compensatory down‐regulation, presumably to prevent excessive de novo lipogenesis in adipose tissue. This trial was registered as ISRCTN31521726

Molecular profiling of signet ring cell colorectal cancer provides a strong rationale for genomic targeted and immune checkpoint inhibitor therapies

We would like to thank all patients whose samples were used in this study. We are also thankful to the Northern Ireland Biobank and Grampian Biorepository for providing us with tissue blocks and patient data; and Dr HG Coleman (Queen’s University Belfast) for her advice on statistical analyses. This work has been carried out with financial support from Cancer Research UK (grant: C11512/A18067), Experimental Cancer Medicine Centre Network (grant: C36697/A15590 from Cancer Research UK and the NI Health and Social Care Research and Development Division), the Sean Crummey Memorial Fund and the Tom Simms Memorial Fund. The Northern Ireland Biobank is funded by HSC Research and Development Division of the Public Health Agency in Northern Ireland and Cancer Research UK through the Belfast CRUK Centre and the Northern Ireland Experimental Cancer Medicine Centre; additional support was received from Friends of the Cancer Centre. The Northern Ireland Molecular Pathology Laboratory which is responsible for creating resources for the Northern Ireland Biobank has received funding from Cancer Research UK, Friends of the Cancer Centre and Sean Crummey Foundation.Peer reviewedPublisher PD

Effects of Total Resources, Resource Ratios, and Species Richness on Algal Productivity and Evenness at Both Metacommunity and Local Scales

The study of the interrelationship between productivity and biodiversity is a major research field in ecology. Theory predicts that if essential resources are heterogeneously distributed across a metacommunity, single species may dominate productivity in individual metacommunity patches, but a mixture of species will maximize productivity across the whole metacommunity. It also predicts that a balanced supply of resources within local patches should favor species coexistence, whereas resource imbalance would favor the dominance of one species. We performed an experiment with five freshwater algal species to study the effects of total supply of resources, their ratios, and species richness on biovolume production and evenness at the scale of both local patches and metacommunities. Generally, algal biovolume increased, whereas algal resource use efficiency (RUE) and evenness decreased with increasing total supply of resources in mixed communities containing all five species. In contrast to predictions for biovolume production, the species mixtures did not outperform all monocultures at the scale of metacommunities. In other words, we observed no general transgressive overyielding. However, RUE was always higher in mixtures than predicted from monocultures, and analyses indicate that resource partitioning or facilitation in mixtures resulted in higher-than-expected productivity at high resource supply. Contrasting our predictions for the local scale, balanced supply of resources did not generally favor higher local evenness, however lowest evenness was confined to patches with the most imbalanced supply. Thus, our study provides mixed support for recent theoretical advancements to understand biodiversity-productivity relationships

Interactions between metal ions and DNA

84 years elapsed between the announcements of the periodic table and that of the DNA double helix in 1953, and the two have been combined in many ways since then. In this chapter an outline of the fundamentals of DNA structure leads into a range of examples showing how the natural magnesium and potassium ions found in nature can be substituted in a diversity of applications. The dynamic structures found in nature have been studied in the more controlled but artificial environment of the DNA crystal using examples from sodium to platinum and also in a range of DNA-binding metal complexes. While NMR is an essential technique for studying nucleic acid structure and conformation, most of our knowledge of metal ion binding has come from X-ray crystallography. These days the structures studied, and therefore also the diversity of metal binding, go beyond the double helix to triplexes, hairpin loops, junctions and quadruplexes, and the chapter describes briefly how these pieces fit into the DNA jigsaw. In a final section, the roles of metal cations in the crystallisation of new DNA structures are discussed, along with an introduction to the versatility of the periodic table of absorption edges for nucleic acid structure determination

Nitrile substituents at the conjugated dipyridophenazine moiety as infra-red redox markers in electrochemically reduced heteroleptic Ru(II) polypyridyl complexes

Ruthenium(II) complexes [Ru(tap)2(NN)]2+ (tap = 1,4,5,8-tetraazaphenanthrene, NN = 11-cyano-dipyrido[3,2-a:2’,3’-c]phenazine (11-CN-dppz) and 11,12-dicyano-dipyrido[3,2-a:2’,3’-c]phenazine (11,12-CN-dppz)) feature the C≡N groups as IR-active redox markers. They were studied by cyclic voltammetry, UV-Vis and IR spectroelectrochemistry (SEC), and DFT calculations to assign the four 1e– reduction waves R1–R4 observed in dichloromethane. Generally, the NN ligands are reduced first (R1). For [Ru(tap)2(11,12-CN-dppz)]2+, R1 is sufficiently separated from R2 delocalized over both tap ligands. Accordingly, IR SEC conducted at R1 shows a large red shift of the s,as(CN) modes by –18/–28 cm–1, accompanied by 4-fold enhancement of the s(CN) intensity, comparably with reference data for free 11,12-CN-dppz. The first tap-based reduction of spin-doublet [Ru(tap)2(11,12-CN-dppz)]+ to spin-triplet [Ru(tap)2(11,12-CN-dppz)] at R2 decreased (CN) by mere –2 cm–1 whilst the intensity enhancement reached an overall factor of 8. Comparably, a red shift of (CN) by –27 cm–1 resulted from the 1e– reduction of [Ru(tap)2(11-CN-dppz)]2+ at R1 (poorly resolved from R2) and the intensity enhancement was roughly 3-fold. Concomitant 1e– reductions of the tap ligands (R2 and R3) caused only minor (CN) shifts of –3 cm–1 and increased the absorbance by an overall factor of 6.5 and 8, respectively

Interactions of small molecules with DNA junctions

International audienceAbstract The four natural DNA bases (A, T, G and C) associate in base pairs (A = C and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases

Interactions of small molecules with DNA junctions

International audienceAbstract The four natural DNA bases (A, T, G and C) associate in base pairs (A = C and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases